9 urn:lsid:arphahub.com:pub:F9D0807C-3C52-5A33-8AB6-FB2607A29353 urn:lsid:zoobank.org:pub:E14246FD-79C0-4B14-A52F-3F6A3D7ECCA8 Subterranean Biology SB 1768-1448 1314-2615 Pensoft Publishers 10.3897/subtbiol.57.196126 196126 Research Article Moniligastridae Evolutionary biology Molecular systematics Phylogeny Taxonomy Zoology & Animal Biology Cenozoic Central Asia Extension of west boundary of Moniligastridae (Oligochaeta) in East Asia: Integrative taxonomy discloses a new species of the genus Drawida Michaelsen, 1900 from Northwest China Qiao Saiyu https://orcid.org/0009-0002-9964-1352 1 2 Zhang Yufeng https://orcid.org/0000-0002-4066-6355 1 Zhao Huifeng zhaohf@lfnu.edu.cn https://orcid.org/0000-0003-4243-9671 1 Hebei Key Laboratory of Animal Diversity, College of Life Sciences, Langfang Normal University, Langfang 065000, China Hebei Key Laboratory of Zoological Systematics and Application, College of Life Sciences, Hebei University Baoding China https://ror.org/01p884a79 Hebei Key Laboratory of Zoological Systematics and Application, College of Life Sciences, Hebei University, Baoding, 071002, China Hebei Key Laboratory of Animal Diversity, College of Life Sciences, Langfang Normal University Langfang China https://ror.org/05kyq2m47

Corresponding author: Huifeng Zhao (zhaohf@lfnu.edu.cn)

Academic editor: John Reynolds

 2026 17 08 2026 57 221 240 E576D9A3-FEF2-5E80-8FD2-C911F7142B22 EB58ED22-F854-46A6-AFED-B3B1738B6C52 17 04 2026 05 08 2026 Saiyu Qiao, Yufeng Zhang, Huifeng Zhao This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. https://zoobank.org/EB58ED22-F854-46A6-AFED-B3B1738B6C52

A new earthworm species, Drawida xinjiangensissp. nov., was described from the northwestern China using an integrative taxonomic approach that combined morphological examination and molecular data. The new species belongs to the Drawida japonica species complex (DjSC) and is distinguished from its congeners by its body length of 33–70 mm, clitellum in X–XIII (white laterally and dark brown medially), two to three gizzards, one pair of testis sacs suspended on septum 9/10 or 10/11, and cylindrical-shaped white prostate glands that are nearly as long as or longer than the testis sacs. Molecular species delimitation: Assemble Species by Automatic Partitioning (ASAP), Generalised Mixed Yule Coalescent (GMYC), and Bayesian Phylogenetics and Phylogeography (BPP) consistently supported its species status assignment. Phylogenetic analyses based on the nuclear 28S rRNA gene and mitogenomic data revealed that D. xinjiangensissp. nov. forms an independent lineage within the DjSC. This discovery extends the west distribution of moniligastrid species to the arid and semi-arid regions in East Asia and highlights the hidden diversity of earthworms in this under-surveyed area.

 Distribution expansion mitochondrial genome northwestern China Introduction

Earthworms, as macro-soil fauna, serve as keystone species and ecosystem engineers in terrestrial ecosystems (Kooch et al. 2025), yet their overall distribution pattern remains poorly understood, with baseline surveys in western regions and high-altitude areas (e.g., the Qinghai-Tibet Plateau, Xinjiang) remaining relatively limited (Fu et al. 2022; Zhao et al. 2026). Spanning multiple climatic zones from cold temperate to tropical, China features diverse and complex topography, ranging from the eastern coastal plains to the western plateaus and mountains, which support a wide variety of soil and vegetation types that may harbour higher earthworm diversity. Drawida japonica was previously reported from Xinjiang by Huang et al. (2006) in their checklist of Chinese earthworms, and its occurrence in Ürümqi Prefecture (ca. 43.83°N, 83.67°E) was subsequently documented by Xu and Xiao (2011), representing the westernmost distribution record of the Chinese Moniligastridae. However, precise locality data for these records remain unavailable. Given that D. japonica is now recognised as a species complex comprising multiple morphologically similar lineages (Blakemore et al. 2014; Liu et al. 2025b), the taxonomic identities of these historical records remain uncertain.

Moniligastridae Claus, 1880 is a relatively primitive family of earthworms with a fairly extensive distribution and is one of the most naturally widespread among all earthworm families (Narayanan et al. 2024, 2025a, 2025b). This family encompasses 193 species in five genera. Among these, Drawida Michaelsen, 1900 is not only the most species-rich genus with 162 valid species and subspecies (Narayanan et al. 2024; Liu et al. 2025a, 2025b; Tiwari et al. 2025, 2026; Ardra et al. 2026; Fahis et al. 2026; Qiao et al. 2026), but also the most widely distributed genus in Moniligastridae (Gates 1972; Jamieson 1977). Drawida is distributed throughout South, Southeast and East Asia (Gates 1936, 1972; Easton 1981; Blakemore et al. 2014; Anderson et al. 2017; Narayanan et al. 2025a).

The Drawida japonica species complex (DjSC) exhibits highly similar morphological traits, such as grey or dark blue body colour, the identical location of the male pore in 7/8, and the spermathecal pore in 10/11 (Blakemore et al. 2014). However, it harbours interspecific-level genetic divergence and currently encompasses six valid species: D. japonica sensu stricto (Michaelsen, 1892), D. koreana Kobayashi, 1938, D. henanensis Liu & Zhao, 2025, D. sinensis Liu & Zhao, 2025, D. wuxiensis Qiao & Zhao, 2026, and a new species Drawida xinjiangensis sp. nov. described here (Liu et al. 2025b; Qiao et al. 2026). It may also comprise D. calebi Gates, 1945, D. siemsseni Michaelsen, 1910, D. jeholensis Kobayashi, 1940, D. moriokaensis Ohfuchi, 1938, D. keikiensis Kobayashi, 1938, and D. companio Blakemore, 2014 (Stephenson 1923; Kobayashi 1940; Blakemore et al. 2014; Narayanan et al. 2024). Although members of DjSC possess similar morphological traits, molecular species delimitation and phylogenetic analyses of these species demonstrate sufficient genetic divergence to support their recognition as independent species.

Herein, D. xinjiangensis sp. nov. is described based on integrative morphological and molecular analyses. Among its known localities is Shuanghe, Xinjiang, northwestern China (~420 km west of Ürümqi), a record that confirms the family’s occurrence in the region and constitutes its northwesternmost distribution in East Asia.

 Material and methods Samplings

Specimens of the new species were collected from four localities in Xinjiang Uygur Autonomous Region, Ningxia Hui Autonomous Region and Gansu Province, China, using hand-sorting and digging methods (Table 1). Collected earthworms were immediately fixed and stored in 95% ethanol in the field. In the laboratory, all specimens were preserved at −20 °C in the Hebei Key Laboratory of Animal Diversity, Langfang Normal University, Hebei, China (C-HLU).

List of Drawida species in China, incorporated into analysis.

Specimen ID Species Location GPS Coordinates Accession Number
COI 28S AKAP17 FLAD1 Mitogenome
CNWN02_01 D. xinjiangensis sp. nov. Xinjiang: Shuanghe 44.8389°N, 82.3422°E PX978833 PZ011122 PZ111474 PZ111481 PZ099866
CNWN02_02 D. xinjiangensis sp. nov. Xinjiang: Shuanghe 44.8389°N, 82.3422°E PX978834 – PZ111475 PZ111482 –
CNWN02_06 D. xinjiangensis sp. nov. Xinjiang: Shuanghe 44.8389°N, 82.3422°E PX978835 PZ011123 PZ111476 – –
CNWN02_07 D. xinjiangensis sp. nov. Xinjiang: Shuanghe 44.8389°N, 82.3422°E PX978836 – – – –
CNWN02_08 D. xinjiangensis sp. nov. Xinjiang: Shuanghe 44.8389°N, 82.3422°E PX978837 – – – –
CNWN02_09 D. xinjiangensis sp. nov. Xinjiang: Shuanghe 44.8389°N, 82.3422°E PX978838 – – – –
CNWN02_10 D. xinjiangensis sp. nov. Xinjiang: Shuanghe 44.8389°N, 82.3422°E PX978839 – – – –
CNWN14_24 D. xinjiangensis sp. nov. Xinjiang: Huocheng 44.2728°N, 80.8863°E PX978840 PZ011124 PZ111477 PZ111483 –
nxWHS1_1_1 D. xinjiangensis sp. nov. Ningxia: Wuzhong 37.3499°N, 106.1385°E PX978841 – – PZ111486 PZ210304
nxWHS1_2_1 D. xinjiangensis sp. nov. Ningxia: Wuzhong 37.3499°N, 106.1385°E PX978842 – PZ111480 PZ111487 –
nxGXJ1_1_1 D. xinjiangensis sp. nov. Ningxia: Xiji 35.9572°N, 105.7928°E PX978843 PZ011125 PZ111478 PZ111484 PZ210303
nxGXJ1_1_2 D. xinjiangensis sp. nov. Ningxia: Xiji 35.9572°N, 105.7928°E PX978844 PZ011126 PZ111479 PZ111485 –
gsLZ_05 D. xinjiangensis sp. nov. Gansu: linze 39.3427°N, 100.0854°E PZ829985 – – – –
gsLZ_06 D. xinjiangensis sp. nov. Gansu: linze 39.3427°N, 100.0854°E PZ829986 – – – –
CQWX11_21 D. wuxiensis Chongqing: Wuxi 31.5164°N, 109.7331°E PX552882 – – – –
CQWX11_29 D. wuxiensis Chongqing: Wuxi 31.5164°N, 109.7331°E PX552882 – – – –
CQWX11_38 D. wuxiensis Chongqing: Wuxi 31.5164°N, 109.7331°E PX552884 – – – –
CQWX11_39 D. wuxiensis Chongqing: Wuxi 31.5164°N, 109.7331°E PX552885 – – – –
CQWX11_44 D. wuxiensis Chongqing: Wuxi 31.5164°N, 109.7331°E PX552886 – – – –
CQWX11_45 D. wuxiensis Chongqing: Wuxi 31.5164°N, 109.7331°E PX552887 PX558007 – – PX369605
CQWX11_55 D. wuxiensis Chongqing: Wuxi 31.5164°N, 109.7331°E PX552888 PX558008 – – –
CQWX05_37 D. wuxiensis Chongqing: Wuxi 31.4680°N, 109.8618°E PX552881 PX558006 – – PZ210301
CQWX15_05 D. wuxiensis Chongqing: Wuxi 31.5087°N, 109.8218°E PX552889 PX558009 – – PZ210302
CQWX15_06 D. wuxiensis Chongqing: Wuxi 31.5087°N, 109.8218°E PX552890 PX558010 – – –
CQWX15_22 D. wuxiensis Chongqing: Wuxi 31.5087°N, 109.8218°E PX552891 PX558011 – – –
HNLN_GR_I1_02 D. henanensis Henan: Luoning 34.4364°N, 111.6368°E PQ288546 PQ432438 – – PQ278996
HNLN_GR_I2_23 D. henanensis Henan: Luoning 34.4364°N, 111.6368°E PQ288549 PQ432440 – – PQ278997
HNLN_GR_I2_26 D. henanensis Henan: Luoning 34.4364°N, 111.6368°E PQ288552 PQ432439 – – –
HNLN_GR_I2_27 D. henanensis Henan: Luoning 34.4364°N, 111.6368°E PQ288553 PQ432436 – – –
HNLN_GR_I2_29 D. henanensis Henan: Luoning 34.4364°N, 111.6368°E PQ288555 PQ432437 PQ452816 PQ452825 -
HNLN_GR_I2_44 D. henanensis Henan: Luoning 34.4364°N, 111.6368°E PQ288562 – – – –
HNLN_GR_I2_51 D. henanensis Henan: Luoning 34.4364°N, 111.6368°E PQ288569 PQ432444 – – –
HNLN_GR_I2_53 D. henanensis Henan: Luoning 34.4364°N, 111.6368°E PQ288571 PQ432445 – – –
HNLN_GR_I2_54 D. henanensis Henan: Luoning 34.4364°N, 111.6368°E PQ288572 PQ432446 – – –
HNLN_GR_I3_29 D. sinensis Henan: Luoning 34.4364°N, 111.6368°E PQ288581 PQ432449 – – –
HNLN_GR_I2_34 D. sinensis Henan: Luoning 34.4364°N, 111.6368°E PQ288559 PQ432441 PQ452815 PQ452828 PQ278998
HNLN_GR_I2_40 D. sinensis Henan: Luoning 34.4364°N, 111.6368°E PQ288561 PQ432443 PQ452813 PQ452830 PQ278999
HNLN_GR_I3_02 D. japonica s. s. Henan: Luoning 34.4364°N, 111.6368°E PQ288578 PQ432448 PQ452809 PQ452827 -
HNLN_GR_I2_36 D. japonica s. s. Henan: Luoning 34.4364°N, 111.6368°E PQ288560 PQ432442 PQ452814 PQ452829 -
HNLN_GR_I3_01 D. japonica s. s. Henan: Luoning 34.4364°N, 111.6368°E PQ288577 PQ432447 PQ452810 PQ452826 PQ279000
360R02 D. japonica s. s. – – – – – – PZ168348
E20_02 D. japonica s. s. – – – – – – PZ168350
DLS_35 D. gisti – – PX369606 – – – PX369606
E6_10 D. gisti – – PX369607 – – – PX369607
– E. irregularis – – – – – – OP381032
– M. anisodiverticulus – – – – – – PV591013
DNA extraction, amplification, and sequencing

This study adopts an integrative taxonomic approach combining morphological evidence with multi-locus molecular data (mitochondrial cytochrome c oxidase subunit I, COI; nuclear 28S ribosomal RNA gene, 28S; A-kinase anchor protein 17A, AKAP17; flavin adenine dinucleotide synthetase 1, FLAD1) to delimit the new species. Phylogenetic analyses were conducted using maximum likelihood and Bayesian inference, and species boundaries were assessed using three molecular delimitation methods: namely the Assemble Species by Automatic Partitioning (ASAP, Puillandre et al. 2021), the Generalized Mixed Yule Coalescent (GMYC, Fujisawa and Barraclough 2013), and Bayesian Phylogenetics and Phylogeography (BPP, Yang and Rannala 2010). Genomic DNA was extracted from the posterior tissues using a commercial kit (TIANGEN, Beijing, China). COI and 28S were amplified using standard PCR, whereas AKAP17 and FLAD1 were amplified using nested PCR. PCR products were verified by agarose gel electrophoresis and Sanger sequencing (Tianyi Huiyuan, Beijing). The primer sequences are listed in Table 2. Sequences were aligned in MEGA 5 (Tamura et al. 2011), and COI genetic distances were calculated using the Kimura two-parameter (K2P) model (Kimura 1980) (Table 3).

Primers used for PCR and sequencing in this study.

Maker primer Sequence (5’-3’) Round Source
COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA
28S 28sF1 GAGTACGTGAAACCGTCTAG Pérez-Losada et al. (2009)
28SR1 CGTTTCGTCCCCAAGGCCTC
AKAP17 AKAP17-F1 AAYTGGGARGTNATGGARAA Round1 Liu et al. 2025a
AKAP17-R1 TCYTTRAACATNARYTTCAT
AKAP17-F2 AARATGATHAARCCNGAYCARTT Round2
AKAP17-R2 GCYTTNACRAANCCCATRTAYTC
FLAD1 FLAD1-F1 GGNCCNACNCAYGAYGAYAT Round1
FLDA1-R1 TTNGGRTGNGTRTTYTCCAT
FLDA1-F2 TGYAARGCNTTYTTYGGNACNGA Round2
FLAD1-R2 TTNACNCKCATRAAYTCNGGCCA

The COI genetic distance of K2P of groups of DjSC (values in %, and indicate intra-species genetic distance in parentheses).

Species 1 2 3 4 5 6
1 D. xinjiangensis sp. nov. (0–0.6)
2 D. wuxiensis 18.8–19.3 (0–0.6)
3 D. henanensis 18.9–20.4 20.3–21.3 (0.2–6.9)
4 D. japonica s. s. 17.4–18.3 19.0–19.3 18.9–20.7 (0–0.2)
5 D. sinensis 18.8–19.2 19.5–20.0 17.4–19.8 18.4–19.9 (12.1)
6 D. koreana 17.1–18.1 18.8–19.3 18.6–20.7 9.7–12.2 15.5–16.2 (7)
High-throughput sequencing and mitochondrial genome (mitogenome) annotation

To determine the phylogenetic position of D. xinjiangensis sp. nov., the mitogenomes of three specimens (CNWN02_01, nxWHS1_1_1, and nxGXJ1_1_1) and two specimens of D. wuxiensis (CQWX05_37 and CQWX15_05) were obtained via high-throughput sequencing using a paired-end 150 bp strategy on the DNBSEQ-T7 platform at BGI Genomics (Wuhan, China). Clean data filtration followed the procedure described by Zhao et al. (2022). Mitogenomes were assembled using MitoZ v2.4 (Meng et al. 2019), and the circular conformation of each assembly was verified using the circle_check.py script from the MitoZ toolkit. The annotated circular mitogenome sequences were submitted to GenBank (Table 1).

 Phylogenetic analyses

Phylogenetic analyses were performed using two datasets. The first dataset comprised 13 protein-coding genes (PCGs) extracted from the mitogenomes of D. xinjiangensis sp. nov., with two enchytraeid species as outgroups. The second dataset consisted solely of the 28S gene, with Drawida gisti as the outgroup. Sequences were aligned using MAFFT (Rozewicki et al. 2019). For both datasets, the best-fit nucleotide substitution models were selected using jModelTest-NG (Darriba et al. 2020) under the Akaike Information Criterion (AIC): GTR+I+G4 for PCGs and 28S.

Maximum Likelihood (ML) trees were reconstructed using RAxML 8.2.12 (Stamatakis 2014) with the GTR+GAMMA model. Nodal support was assessed with 1,000 rapid bootstrap replicates, and only branches with bootstrap values (BV) ≥ 50% were retained. Bayesian Inference (BI) was conducted in MrBayes 3.2.6 (Ronquist et al. 2012) using Markov Chain Monte Carlo (MCMC) runs of two million generations, ensuring that the average standard deviation of split frequencies fell below 0.01. The results of the BI p-files were examined in Tracer v.1.7.5 (Rambaut et al. 2018), and effective sampling size (ESS) values larger than 200 were accepted. Posterior probabilities (PP) ≥ 0.95 were considered well-supported. All trees were visualized using FigTree v1.4.4 (https://tree.bio.ed.ac.uk/software/figtree/).

 Molecular species delimitation

Species boundaries were assessed using three molecular delimitation methods: ASAP, GMYC, and BPP. For single locus analyses, the mitochondrial COI and nuclear 28S genes were analyzed with both ASAP and GMYC. ASAP was performed using the online portal (https://bioinfo.mnhn.fr/abi/public/asap). For GMYC, ultrametric trees for COI and 28S were inferred in BEAST v1.7.5 (Drummond et al. 2012) under a Yule prior and strict clock, with consensus trees summarized in TreeAnnotator; GMYC analysis was then performed using the SPLITS package in R (Ezard et al. 2017). Multi-locus validation was performed using BPP v2.2 (Yang and Rannala 2010) on the four-gene dataset (COI, 28S, AKAP17, and FLAD1) under the multispecies coalescent model. Two analyses were conducted: first, an A00 analysis to estimate population size (θ) and divergence time (τ) using a fixed species tree; second, an A10 analysis for species delimitation. Prior settings: θ ~ G (3, 1000) (mean = 0.003); root divergence τ0 ~ G (3, 2000) (mean = 0.0015); other τ parameters assigned a uniform Dirichlet distribution (Yang 2002, 2015; Rannala and Yang 2003; Flouri et al. 2018).

 Morphological species delimitation

Eight clitellates (CNWN02_01, CNWN02_02, CNWN02_06, CNWN02_07, CNWN14_24, nxGXJ1_1_1, nxGXJ1_1_2 and nxWHS1_1_1) were examined for both external and internal morphology using a ZEISS stereomicroscope, with images acquired using ZEN 3.3 pro software. Body length and width were measured to the nearest 0.1 mm. Specimens preserved weight is provided using electronic analytical balance. The prostomium, male and female pores, and spermathecal pores were recorded. Internal structures, including spermathecae, testis sacs and gizzards, were dissected and sketched for interspecific comparison. Taxonomic identification followed Blakemore et al. (2014), Michaelsen (1892), and Xu and Xiao (2011). All measurements were performed on alcohol-preserved specimens. A comparison of key morphological characters among species of the D. japonica complex is presented in Table 4.

Key morphological characteristics of the species Drawida japonica complex (NA: not available).

Characteristic D. xinjiangensis sp. nov. D. wuxiensis D. henanensis D. sinensis D. japonica s. s. D. koreana D. calebi D. jeholensis D. siemsseni D. moriokaensis D. keikiensis D. companio
Color Pine green Grey Grey Grey Grey/Pale Dark blue Unpigmented Whitish grey Buff Grey Yellow/grey Dark bluish
Length 33–70 22–47 24–47 41.8–52 28–70 63–100 35–83 52–66 110 65–100 40–54 80+
Width 3.5–5.0 3–5.5 1.8–3 3.5–4 2–4.5 Up to 4 2–4.5 up to 3.5 2–4 ≤ 3.9 up to 2.5 NA
Genital markings 7–10/11/13, unpaired 7/8–13, unpaired 7–11, unpaired 7–11, un-paired 7–13, unpaired 7–12, irregular 7–13, variously 7–11 7–12, irregular None None 8
Clitellum 10–13; White-surrounded brown 10–13; light pink 10–13; light grey 10–13; grayish white 9/10–13, ½14 10–13; pinkish NA 9–14 10–13 10–13 10–13 10–13
Spermathecae ducts Medium coiled Medium coiled Medium coiled Tight coiled Long coiled Short less coiled Long coiled Convoluted Long coiled Medium coiled Long coiled Moderately long
Spermathecae Atrium Ellipsoidal in 8 Small oval-like in 8 Long sac-like and small in 8 Long sac-like and small in 8 Thumb-like and large in 8 Short, sac-like in 7 Conical in 8 Large in 7/8 Present in 8 Small in 7/8 Small oral in 7/8 Small
Form of male pores Circularly protruding on 10/11 Spindle-shaped on 10/11 Penis-like overhanging on 10/11 Raised on 10/11 Stubby flab on 10 near 10/11 Penis-like on 10 near 10/11 Short penis at 10/11 10/11 10/11 Short and stout Penis in pouch in 10/11 Penis in pouch in 10/11 10/11
Female pore External invisible Absent Absent Absent 11/12; near b-line 12; in b-line NA 12; in ab-line NA 12, near 11/12 11/12; in b-line 12; in b-line
Ovisacs 10/11–13/15 12–13, extend to 15,16 12–20 12–15 11/12–16 12–18, seldom 22 /23 20 16–20 NA Ovarian chamber in 10/11/12 with egg sacs 10/11/12–16 or 22 14
Gizzard segments and position 2 or 3; 12–16 or13–17 3; 12–18 2 or 3; 11,12–13/14/16 2; 11–13 2 or 3; 11/12–13/14 2 or 3; 12–14 2–4; 12–17 2 or 3; 11, 12–13 6 2–3; 10/ 11–12? 3–4; 12/13–15 3; 12–14
Vas deferens Slender and loosely coiled Slender and less coiled Slender and less coiled Long coiled Coiled and twisted Loosely twisted Short coiled Short NA Coiled Short coiled Coiled
Prostate Cylindrical -shaped white Irregular disc-shaped Elliptical white and thick disc-shaped Long white and thick Club-shaped and erect Thumb-shaped Sessile and smooth Small and rugose NA NA Small and short, but broad and warty on surface Small and white
Results Taxonomy

Family Moniligastridae Claus, 1880

Genus <italic><tp:taxon-name><tp:taxon-name-part taxon-name-part-type="genus" reg="Drawida">Drawida</tp:taxon-name-part></tp:taxon-name></italic> Michaelsen, 1900 Animalia Moniligastrida Moniligastridae 45F6CFED-9382-5D40-AA35-CC5CE797BE23 Drawida xinjiangensis https://zoobank.org/F19F3D91-E196-4921-9EC6-C832C8D35CC5 Qiao & Zhao sp. nov. Type specimens.

Holotype • Clitellate specimen (34 mm in total length, dissected), Chang’an Road, Shuanghe County, Xinjiang Uygur Autonomous Region, China, 44.8389°N, 82.3422°E, 1,943 m elev., 21 May 2025, coll. Yufeng Zhang (CNWN02_02). Paratypes • Three clitellates (CNWN02_01, CNWN02_06, CNWN02_07), data the same as the holotype. Other specimens • Four clitellates. One clitellate, Lucaogou Town, Huocheng County, Ili Kazakh Autonomous Prefecture, Xinjiang, China, 44.2728°N, 80.8863°E, 1,857 m elev., 27 May 2025, coll. Yufeng Zhang (CNWN14_24). Two clitellates (nxGXJ1_1_1, nxGXJ1_1_2), Xiji County, Guyuan Prefecture, Ningxia, China, 35.9572°N, 105.7928°E, 850 m elev., 13 Aug 2025, coll. Yanmeng Bi. One clitellate (nxWHS1_1_1), Hongsibao District, Wuzhong Prefecture, Ningxia, China, 37.3499°N, 106.1385°E, 1,391 m elev., 13 Aug 2025, coll. Yanmeng Bi. All specimens are preserved in C-HLU.

 Diagnosis.

Length 33–70 mm, diameter 3.5–5.0 mm, weight 0.10–0.50 g. Segments numbering 97–148. Prostomium prolobous. Dorsal pores absent. Setae lumbricine, short, closely paired. Clitellum in X–XIII, white on both sides, dark brown in the middle, are swollen segments. Spermathecal pores one pair in 7/8, each pore medial to seta c, slit-like. Male pore one pair circularly protruding and close to seta b in 10/11, with or without genital papillae on the top. Female pore external invisible. Genital markings present as small, white, papilla-like protuberances, unpaired irregularly in VII–X/XI/XIII. Gizzards two to three, round, white, muscular and shining. Testis sacs one pair, large, each suspended on septum 9/10 or 10/11. Vas deferens slender and loosely coiled in IX–X, opening ventrally, with a long cylindrical shaped white prostate gland beside it in X. Spermathecae paired, ampulla globosely, duct moderately long, somewhat tortuous, atrium ellipsoidal or thumb-shaped.

 Description.

CNWN02_02: length 34 mm, diameter 5.0 mm, segments number 97; CNWN02_01: length 33 mm, diameter 4.5 mm, segments number 139; CNWN02_06: length 30 mm, diameter 4.0 mm, segments number 111; CNWN02_07: length 28.5 mm, diameter 3.5 mm, segments number 143; CNWN14_24: length 40 mm, diameter 3.5 mm, segments number 132; nxGXJ1_1_1: length 70 mm, diameter 5.0 mm, segments number 140; nxGXJ1_1_2: length 54 mm, diameter 4.5 mm, segments number 130; nxWHS1_1_1: length 48 mm, diameter 4.0 mm, segments number 148. Prostomium prolobous (Fig. 1A). Dorsal pores absent. Head dark blue. Setae lumbricine, closely paired, ab: cd: aa: bc: dd = 1: 0.845: 5.207: 6.418: 21.563 (segment 9) (Fig. 1B, J). Clitellum in X–XIII, white on both sides, dark brown in the middle, swollen (Fig. 1C). Penes invisible. Spermathecal pores one pair in 7/8, slit-like, edge slightly wrinkled close to setae c than d. Male pore one pair circularly protruding and close to setae b in 10/11, at the ventral tip of the protuberance. Female pore external invisible. Genital markings present as small, white, papilla-like protuberances, unpaired irregularly in VII–X/XI/XIII. Preserved specimen light brown, and dark brown around clitellum.

10.3897/subtbiol.57.196126.figure1 80483716-680E-508B-8DEE-3AEA08240520

Drawida xinjiangensis sp. nov., holotype (ID: CNWN02_02). A. Ventral view of the prostomium; B, J. Ventral view of male pores, spermathecal pores and genital markings; C. Dorsal view of clitellum region; D. Ventral view of gizzards; E, H. Right spermathecae; F, I. Right testis sac, with vas deferens and prostate gland; G. Ventral view of ovisacs; Scale bars: 0.5 mm (A–C, J); 0.2 mm (D–I).

https://binary.pensoft.net/fig/1747520 Internal.

Septa 5/6–8/9 thick and muscular, 9/10 thin. Gizzards two or three in segments XII–XVI or XIII–XVII, round, white, muscular and shining (Fig. 1D). Hearts are four pairs in VI–IX. Testis sacs one pair, large, oval, each suspended on septum 9/10 or 10/11, 0.96–1.48 mm in length and 0.67–1.30 mm in width, vas deferens slender and loosely coiled in IX–X, opening ventrally, with a long cylindrical shaped white prostate gland beside it in X, standing on the ventral surface (Fig. 1F, I). Prostate gland 0.92–1.67 mm in length, nearly as long as or longer than testis sacs, 0.51–0.64 mm in width. Ovarian chamber absent, the ovaries are exposed, white and feather-shaped, in front of the gizzard on dorsal side. Ovisacs paired, pale yellow, situated bilaterally to and overlapping the gizzard, extending posteriorly to XIII–XV, moniliform or narrowed by intersegment septa. Spermathecae paired: ampulla globosely, situated anteriorly to VIII, 0.48–0.56 × 0.37–0.53 mm; duct moderately long, somewhat tortuous, joining the ental side of the atrium (Fig. 1E, H). Atrium ellipsoidal or thumb-shaped, 0.37–0.71 × 0.15–0.32 mm.

 Etymology.

The species name refers to the type locality, Xinjiang, China.

 Distribution.

Xinjiang, Ningxia and Gansu (China).

 Habitat.

Secondary forest and farmland.

 Remarks.

For the external characters, the new species has a body length of 33–70 mm, differing from D. wuxiensis and D. henanensis but resembling D. japonica s. s in length. In body colour, the new species exhibits a brown in alcohol, in contrast to the dark blue, buff and blotchy olive coloration of D. koreana, D. siemsseni and D. impertusa (Hong 2002; Blakemore et al. 2014), as well as the grey body colour of D. wuxiensis, D. henanensis, D. japonica s. s. and D. sinensis.

For the internal characters, D. xinjiangensis sp. nov. most closely resembles D. henanensis, D. japonica s. s., D. sinensis and D. wuxiensis, but can be distinguished from D. wuxiensis by possessing cylindrical-shaped white prostate glands (vs. disc-shaped prostate glands in D. wuxiensis), and it can differ from D. henanensis and D. sinensis by having large atrium (the atrium of D. henanensis and D. sinensis are small and oval-shaped, The new species differs from D. japonica s. s. in having slender and loosely coiled vas deferens (vs. coiled and twisted vas deference in D. japonica s. s.). It is separated from D. sinensis by its more swollen clitellum and slender, loosely coiled vas deferens (vs. indistinct clitellum and long, tightly coiled vas deferens in D. sinensis). Furthermore, the new species bears paired, cylindrical-shaped white prostate glands whose length is nearly equal to or exceeds that of the testis sacs, with a volume ratio of approximately 1:1. By comparison, this ratio is 1:3 in D. henanensis, 1:4 in D. wuxiensis, 1:2 in D. japonica s. s., and 3:4 in D. sinensis.

 Molecular species delimitation

Three complementary methods—ASAP, GMYC, and BPP—were employed to delimit molecular operational taxonomic units (MOTUs) (Fig. 2). Analysis of the four-locus dataset with BPP consistently recovered the five morphologically defined species as distinct MOTUs. Single-locus analyses of 28S rRNA using both ASAP and GMYC yielded delimitations fully congruent with the morphological assignments. In contrast, COI-based delimitations deviated from morphological boundaries, with ASAP and GMYC subdividing D. henanensis and D. sinensis into two MOTUs. The K2P distances based on COI further supported the genetic integrity of the new species with the genetic distances between D. xinjiangensis sp. nov. and all other DjSC species fell a range of between 17.1% and 21.2% (Table 3).

10.3897/subtbiol.57.196126.figure2 C8DD422F-D5C0-51B5-A341-809E47C47896

Species delimitation of Drawida japonica species complex (DjSC). The bold bars show the species taxonomic unit that were delimited by morphological characters and molecular data.

https://binary.pensoft.net/fig/1747521 Phylogenetic relationship of <abbrev xlink:title="Drawida japonica species complex">DjSC</abbrev>

The mitogenome of the new species, Drawida xinjiangensis sp. nov., was 1,5495–15,499 bp in length and contained the canonical set of 37 genes: 13 protein-coding genes (PCGs), two ribosomal RNA genes (rRNAs), 22 transfer RNA genes (tRNAs), and a putative control region (Fig. 3; Suppl. material 1). Control region (CR) is present in the new species, with a length of 873 bp and located at positions 7,622–8,494 bp in CNWN02_02; a length of 871 bp and located at positions 7,619–8,489 bp in nxGXJ1_1_1; a length of 873 bp and located at positions 7,618–8,490 bp in nxWHS1_1_1.

10.3897/subtbiol.57.196126.figure3 00BB9ECF-8ECF-5216-8874-3760F22E24CA

The circular mitogenome of Drawida xinjiangensis sp. nov. The inner circle indicates the GC content, purple indicates the coverage across the mitogenome, and the outer circle shows the arrangement of the genes.

https://binary.pensoft.net/fig/1747522

Phylogenetic analysis based on the concatenated PCGs (Fig. 4) showed that DjSC formed a well-supported monophyletic group. Within this clade, the new species, D. xinjiangensis sp. nov., was recovered as the sister group to D. henanensis with a very low bootstrap value (BS) of 38%. In contrast, the single-gene phylogeny based on 28S rRNA (Fig. 5) places D. xinjiangensis sp. nov. as an independent monophyletic lineage, clearly separated from all other members of DjSC.

10.3897/subtbiol.57.196126.figure4 3D98485F-60D1-5C3E-B8EA-0E285A59C400

Phylogenetic trees of Drawida japonica species complex (DjSC) using the maximum likelihood method and Bayesian Inference based on the PCGs of mitogenomes. Values with a bootstrap value below 50 and a posterior probability lower than 0.80 have been omitted. Orange tips showed the new species.

https://binary.pensoft.net/fig/1747523 10.3897/subtbiol.57.196126.figure5 1B778F8D-BE9D-5921-A17A-BEB5CFCF9513

Phylogenetic trees of Drawida japonica species complex (DjSC) based on nuclear marker 28S rRNA using the maximum likelihood method and Bayesian Inference. Numbers near branches indicate the maximum likelihood bootstrap support/Bayesian posterior probabilities. Bootstrap values and posterior probabilities are indicated on the tree. For clarity, values with a bootstrap value below 50 and a posterior probability lower than 0.80 have been omitted.

https://binary.pensoft.net/fig/1747524 Discussion

In this study, an integrative taxonomic approach combining morphological comparisons and molecular analyses was used to describe D. xinjiangensis sp. nov. from northwestern China. Morphologically, the new species differs from other members of the DjSC in body length, body colour, and the relative proportions of the ampulla to the atrium and the testis sacs to the prostate glands. Molecularly, it is supported as an independent species by genetic distances of 17.1%–21.2% from all other DjSC species—well above the 15% inter-specific threshold routinely applied in earthworm taxonomy (Dong et al. 2019; Chang et al. 2024; Han et al. 2024, 2026; Qin et al. 2025; Zhao et al. 2025). This discovery expands the known species diversity of DjSC, meanwhile, extends the west distribution boundary of moniligastrids into the arid and semi-arid regions of northwestern China. For now, Moniligastridae occurs in most regions of China except the Qinghai-Tibet Plateau (Xu and Xiao 2011; Shen et al. 2018; Narayanan et al. 2024; Liu et al. 2025a, 2025b; Qiao et al. 2026).

The mitogenome of D. xinjiangensis sp. nov. contains an ca. 873 bp putative control region, a feature that contrasts with most previously sequenced DjSC mitogenomes, where this region is typically absent (Zhang et al. 2016; Qiao et al. 2026). However, we acknowledge that the assembly of AT-rich repetitive non-coding regions from short-read data is prone to errors due to sequencing bias and the difficulty in resolving repetitive structures (Aird et al. 2011; Formenti et al. 2021). Therefore, we designated this region as “putative” and emphasized that its accurate sequence requires independent validation via Sanger or long-read sequencing in future studies. Importantly, the 13 PCGs used for phylogenetic reconstruction were complete and unaffected by this uncertainty, ensuring that the core taxonomic conclusions of this study remained robust.

The phylogenetic relationships of D. xinjiangensis sp. nov., D. henanensis, D. sinensis, and D. japonica s. s. are difficult to resolve in both mitogenomic and 28S datasets (Figs 4, 5). While the mitochondrial tree places D. xinjiangensis as the sister to D. henanensis, this node receives very low support (BS = 38%), whereas the nuclear 28S tree recovers the new species as a distinct monophyletic lineage. This mito-nuclear discordance may be explained by mitochondrial introgression following historical hybridization, incomplete lineage sorting of ancestral polymorphisms (Schmidt et al. 2006; Matsuda et al. 2014; Papakostas et al. 2016), or limited phylogenetic signal from the mitochondrial genome alone—a phenomenon increasingly documented in earthworms (Giska et al. 2015; Martinsson and Erséus 2017; Dupont et al. 2022). Nevertheless, the well-supported independent lineage in the nuclear tree, together with stable morphological differences, strongly supports the species status of D. xinjiangensis sp. nov. Future investigations employing whole-genome or reduced-representation datasets, such as UCE (Ultraconserved Elements), AHE (Anchored Hybrid Enrichment), will be needed to further resolve phylogenetic affinities within the DjSC.

Drawida xinjiangensis sp. nov. is currently known from five localities in arid and semi-arid northwestern China, each supporting locally humid microhabitats maintained by natural features or human intervention. The type locality, Shuanghe City (northern Tianshan foothills), is a typical oasis fed by glacial meltwater from the Bortala and Jinghe rivers, supplemented by urban water systems (Tian and Xu 2020). The Alataw Pass, a natural corridor linking China to Central Asia and Europe, supports humid riparian habitats west of the pass that may facilitate dispersal into Kazakhstan. Adjacent regions may also harbour additional undiscovered moniligastrid species, warranting further surveys. However, human-mediated introduction cannot be ruled out, as all known localities are anthropogenically modified (farmlands and urban green spaces), and earthworms are readily dispersed via agricultural activities. Future population genomic analyses of natural habitats adjacent to the collection sites will be required to distinguish natural dispersal from anthropogenic introduction.

 Acknowledgments

We thanked the three referees: Samuel James and the two anonymous reviewers, for their improvement of the manuscript. And we thanked Yanmeng Bi and Pingping Yao (Tianjin Chengjian University) for their collection in Ningxia, as well as Jiliang Liu and Qiyue Yang (Northwest Institute of Eco-Environment and Resources, Chinese Academy of Sciences) for their assistance with specimen collection in Gansu Province.

 References Aird D, Ross MG, Chen WS, Danielsson M, Fennell T, Russ C, Jaffe DB, Nusbaum C, Gnirke A (2011) Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Biology 12: R18. https://doi.org/10.1186/gb-2011-12-2-r18 Anderson FE, Williams BW, Horn KM, Erséus C, Halanych KM, Santos SR, James SW (2017) Phylogenomic analyses of Crassiclitellata support major Northern and Southern Hemisphere clades and a Pangaean origin for earthworms. BMC Evolutionary Biology 17(1): 123. https://doi.org/10.1186/s12862-017-0973-4 Ardra RM, Narayanan SP, Kumar PS, Sudhikumar AV, Thomas AP (2026) A new small Drawida Michaelsen, 1900 (Clitellata: Moniligastridae) species from the Western Ghats of Kerala State, India. Zootaxa 5763: 268–280. https://doi.org/10.11646/zootaxa.5763.2.6 Blakemore RJ, Lee S, Seo H-y (2014) Reports of Drawida (Oligochaeta: Moniligastridae) from far East Asia. Journal of Species Research 3: 127–166. https://doi.org/10.12651/JSR.2014.3.2.127 Chang C-H, Shen H-P, Sherlock E, Csuzdi C (2024) A review of the earthworm Amynthas masatakae (Beddard, 1892) (Clitellata, Megascolecidae), with designation of two new synonyms. Biodiversity Data Journal 12: e119599. https://doi.org/10.3897/BDJ.12.e119599 Darriba D, Posada D, Kozlov AM, Stamatakis A, Morel B, Flouri T (2020) ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models. Molecular Biology and Evolution 37: 291–294. https://doi.org/10.1093/molbev/msz189 Dong Y, Law MMS, Jiang J, Qiu J (2019) Three new species and one subspecies of the Amynthas corticis-group from Guangxi Zhuang Autonomous Region, China (Oligochaeta, Megascolecidae). ZooKeys 884: 23–42. https://doi.org/10.3897/zookeys.884.30988 Drummond AJ, Suchard MA, Xie D, Rambaut A (2012) Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29: 1969–1973. https://doi.org/10.1093/molbev/mss075 Dupont L, Audusseau H, Porco D, Butt KR (2022) Mitonuclear discordance and patterns of reproductive isolation in a complex of simultaneously hermaphroditic species, the Allolobophora chlorotica case study. Journal of Evolutionary Biology 35(6): 1–14. https://doi.org/10.1111/jeb.14017 Easton EG (1981) Japanese earthworms: A synopsis of the Megadrile species (Oligochaeta). Bulletin of the British Museum of Natural History 40: 33–65. https://doi.org/10.5281/zenodo.13667647 Ezard TH, Fujisawa T, Barraclough TG (2017) Split: Species Limits and Phylogenetic Analysis (Version 1.0-19). [R Package] Fahis KT, Narayanan SP, Paliwal R, Das KS, Sylas V, Babu N, Thomas AP, Julka M (2026) Unearthing hidden diversity: two new moniligastrid earthworms (Clitellata, Moniligastridae) from Silent Valley National Park of the Western Ghats biodiversity hotspot, Kerala, India. Zootaxa 5760: 189–208. https://doi.org/10.11646/zootaxa.5760.2.2 Flouri T, Jiao X, Rannala B, Yang Z (2018) Species tree inference with BPP using genomic sequences and the multispecies coalescent. Molecular Biology and Evolution 35: 2585–2593. https://doi.org/10.1093/molbev/msy147 Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299. Formenti G, Rhie A, Balacco J, Haase B, Mountcastle J, Fedrigo O, Brown S, Capodiferro MR, Al-Ajli FO, Ambrosini R, Houde P, Koren S, Oliver K, Smith M, Skelton J, Betteridge E, Dolucan J, Corton C, Bista I, Torrance J, Tracey A, Wood J, Uliano-Silva M, Howe K, McCarthy S, Winkler S, Kwak W, Korlach J, Fungtammasan A, Fordham D, Costa V, Mayes S, Chiara M, Horner DS, Myers E, Durbin R, Achilli A, Braun EL, Phillippy AM, Jarvis ED, The Vertebrate Genomes Project Consortium (2021) Complete vertebrate mitogenomes reveal widespread repeats and gene duplications. Genome Biology 22(1): 120. https://doi.org/10.1186/s13059-021-02336-9 Fu S, Liu M, Zhang W, Shao Y (2022) A review of recent advances in the study of geographical distribution and ecological functions of soil fauna diversity. Biodiversity Science 30(10): 22435. https://doi.org/10.17520/biods.2022435 Fujisawa T, Barraclough TG (2013) Delimiting species using single-locus data and the Generalized Mixed Yule Coalescent approach: A revised method and evaluation on simulated data sets. Systematic Biology 62(5): 707–724. https://doi.org/10.1093/sysbio/syt033 Gates GE (1936) On some earthworms from the Cameron Highlands, Pahang. Bulletin of Raffles Museum, Singapore 12: 87–117. Gates GE (1972) Burmese earthworms. An introduction to the systematics and biology of megadrile oligochaetes with special reference to Southeast Asia. Transactions of the American Philosophical Society 62: 1–326. https://doi.org/10.2307/1006214 Giska I, Sechi P, Babik W (2015) Deeply divergent sympatric mitochondrial lineages of the earthworm Lumbricus rubellus are not reproductively isolated. BMC Evolutionary Biology 15: 217. https://doi.org/10.1186/s12862-015-0488-9 Han ACN, Zhang Y, Miao P, Wu S, Xiao N, Qin M, Zhao H, Wu D, Aspe NM (2024) Distribution and systematics of the cosmopolitan Amynthas carnosus complex (Crassiclitellata, Megascolecidae) from eastern Asia. Zoosystematics and Evolution 100: 1061–1073. https://doi.org/10.3897/zse.100.119292 Han ACN, Zhao N, Aspe NM, Nob CJR, Zhang Y, Wu D, Zhao H (2026) A new species of the Amynthas corticis group with support from mitogenomic data and a new record of Metaphire agrestis (Goto & Hatai, 1899) (Oligochaeta, Megascolecidae) in northeastern China. ZooKeys 1266: 231–261. https://doi.org/10.3897/zookeys.1266.161903 Hong Y (2002) New earthworms of the genus Drawida Michaelsen, 1900 (Oligochaeta: Moniligastridae) from Korea. Revue Suisse de Zoologie 109: 475–482. https://doi.org/10.5962/bhl.part.79602 Huang J, Xu Q, Sun ZJ, Wang C, Zheng DM (2006) Research on earthworm resources of China: I. Checklist and distribution. Journal of China Agricultural University 11(3): 9–20. Jamieson BGM (1977) On the phylogeny of the Moniligastridae, with description of new species of Moniligaster (Oligochaeta, Annelida). Evolutionary Theory 2: 95–114. Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16(2): 111–120. https://doi.org/10.1007/BF01731581 Kobayashi S (1940) Terrestrial Oligochaeta from Manchoukuo. The Science Reports of the Tohoku Imperial University, Series 4, 15(3): 261–315. Kooch Y, Heydari M, Parsapour MK, Valkó O (2025) Earthworm: a keystone species of soil quality, health and functions. Acta Oecologica 128: 104106. https://doi.org/10.1016/j.actao.2025.104106 Liu M, Li J, Zhang Y, Aspe NM, Wu D, Zhao H, Zheng G (2025a) A new species of the Drawida ghilarovi species complex (Oligochaeta, Moniligastridae) in Changbai Mountain, Northeast China. Zoosystematics and Evolution 101: 627–641. https://doi.org/10.3897/zse.101.146587 Liu M, Miao P, Liu Z, Aspe NM, Zhang Y, Zhao H (2025b) Two new species of the Drawida japonica species complex (Oligochaeta, Moniligastridae) from East Asia delimited by integrative taxonomic methods. ZooKeys 1264: 377–402. https://doi.org/10.3897/zookeys.1264.170881 Martinsson S, Erséus C (2017) Cryptic speciation and limited hybridization within Lumbricus earthworms (Clitellata: Lumbricidae). Molecular Phylogenetics and Evolution 106: 18–27. https://doi.org/10.1016/j.ympev.2016.09.011 Matsuda T, Morishita M, Hinomoto N, Gotoh T (2014) Phylogenetic analysis of the spider mite sub-family Tetranychinae (Acari: Tetranychidae) based on the mitochondrial COI gene and the 18S and the 5 ‘ end of the 28S rRNA genes indicates that several genera are polyphyletic. PLOS ONE 9: e108672. https://doi.org/10.1371/journal.pone.0108672 Meng G, Li Y, Yang C, Liu S (2019) MitoZ: A toolkit for mitochondrial genome assembly, annotation and visualization. Nucleic Acids Research 47(11): e63. https://doi.org/10.1093/nar/gkz173 Michaelsen W (1892) Terricolen der Berliner Zoologischen Sammlung. II. Archiv für Naturgeschichte 58(1): 209–261. [In German] https://doi.org/10.5962/bhl.part.8321 Narayanan SP, Paliwal R, Thomas AP, Julka JM (2024) Catalogue of the moniligastrid earthworms (Clitellata, Moniligastrida, Moniligastridae) of the world. Zootaxa 5416: 1–66. https://doi.org/10.11646/zootaxa.5416.1.1 Narayanan SP, Ahmed S, Thomas AP (2025a) Description of a new species of the earthworm genus Moniligaster Perrier, 1872 (Clitellata, Moniligastridae) from the Nilgiri Biosphere Reserve of Tamil Nadu State, India. Zootaxa 5589: 142–154. https://doi.org/10.11646/zootaxa.5589.1.12 Narayanan SP, Sylas V, Thomas AP, Julka J, Paliwal R, Thomas AP (2025b) Drawida karatala, a new species of earthworm (Clitellata, Moniligastridae) from the Western Ghats of India. Opuscula Zoologica 56: 97–109. https://opuscula.elte.hu/PDF/Tomus56/Op_Drawida_karatala_Narayanan.pdf Papakostas S, Michaloudi E, Proios K, Brehm M, Verhage L, Rota J, Peña C, Stamou G, Pritchard V, Fontaneto D, Declerck S (2016) Integrative taxonomy recognizes evolutionary units despite widespread mitonuclear discordance: Evidence from a Rotifer cryptic species complex. Systematic Biology 65(3): 508–524. https://doi.org/10.1093/sysbio/syw016 Pérez-Losada M, Ricoy M, Marshall JC, Domínguez J (2009) Phylogenetic assessment of the earthworm Aporrectodea caliginosa species complex (Oligochaeta: Lumbricidae) based on mitochondrial and nuclear DNA sequences. Molecular Phylogenetics and Evolution 52: 293–302. https://doi.org/10.1016/j.ympev.2009.04.003 Puillandre N, Lambert A, Brouillet S, Achaz G (2021) ASAP: Assemble species by automatic partitioning. Molecular Ecology Resources 21(2): 609–620. https://doi.org/10.1111/1755-0998.13281 Qiao S, Zhang F, Qin Y, Zhang Y, Zhao H (2026) A new species of the Drawida japonica species complex (Oligochaeta, Moniligastridae) disclosed by integrative taxonomy in Chongqing, China. ZooKeys 1278: 245–264 https://doi.org/10.3897/zookeys.1278.187038 Qin M, Zhao H, Zhang Y, Han ACN, Shekhovtsov SV, Wu D, Aspe NM (2025) Description of three new subspecies of Eisenia nordenskioldi (Annelida: Crassiclitellata) from Northeastern China. Zootaxa 5642: 325–344. https://doi.org/10.11646/zootaxa.5642.3.2 Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA (2018) Posterior summarization in Bayesian Phylogenetics using tracer 1.7. Systematic Biology 67: 901–904. https://doi.org/10.1093/sysbio/syy032 Rannala B, Yang Z (2003) Bayes estimation of species divergence times and ancestral population sizes using DNA sequences from multiple loci. Genetics 164: 1645–1656. https://doi.org/10.1093/genetics/164.4.1645 Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. https://doi.org/10.1093/sysbio/sys029 Rozewicki J, Li S, Amada K, Standley D, Katoh K (2019) MAFFT-DASH: Integrated protein sequence and structural alignment. Nucleic Acids Research 47: W5–W10. https://doi.org/10.1093/nar/gkz342 Schmidt S, Driver F, Debarro P (2006) The phylogenetic characteristics of three different 28S rRNA gene regions in Encarsia (Insecta, Hymenoptera, Aphelinidae). Organisms Diversity & Evolution 6: 127–139. https://doi.org/10.1016/j.ode.2005.07.002 Shen H-P, Chang C-H, Chih W-J (2018) Two new earthworm species of the genus Drawida (Oligochaeta: Moniligastridae) from southwestern Taiwan. Zootaxa 4496: 302–312. https://doi.org/10.11646/zootaxa.4496.1.25 Stamatakis A (2014) RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30: 1312–1313. https://doi.org/10.1093/bioinformatics/btu033 Stephenson J (1923) The Fauna of British India, including Ceylon and Burma—Oligochaeta. Taylor and Francis, London, 518 pp. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28: 2731–2739. https://doi.org/10.1093/molbev/msr121 Tian C, Xu L (2020) Spatiotemporal correlation between oasis expansion and regional water resources change in the northern piedmont of Tianshan Mountains. Journal of Shihezi University (Natural Science Edition) 38(04): 434–442. https://doi.org/10.13880/j.cnki.65-1174/n.2020.23.013 Tiwari N, Shilpi K, James SW, Yadav S (2025) Integrative taxonomy uncovers four novel species of Drawida Michaelsen, 1900 (Clitellata: Moniligastridae) revealing untapped earthworm diversity in India. Molecular Biology Report 52: 869. https://doi.org/10.1007/s11033-025-10956-8 Tiwari N, Shilpi K, Yadav S (2026) Restoration of Drawida jalpaigurensis Stephenson, 1916 as a distinct species based on molecular and phylogenetic insights. The Nucleus. https://doi.org/10.1007/s13237-026-00641-x Xu Q, Xiao N (2011) Chinese terrestrial earthworms. China Agriculture Press, 44–46, 54–55. Yang Z (2002) Likelihood and Bayes estimation of ancestral population sizes in hominoids using data from multiple loci. Genetics 162: 1811–1823. https://doi.org/10.1093/genetics/162.4.1811 Yang Z (2015) The BPP program for species tree estimation and species delimitation. Current Zoology 61: 854–865. https://doi.org/10.1093/czoolo/61.5.854 Yang Z, Rannala B (2010) Bayesian species delimitation using multilocus sequence data. Proceedings of the National Academy of Sciences 107: 9264–9269. https://doi.org/10.1073/pnas.0913022107 Zhang L, Sechi P, Yuan M, Jiang J, Dong Y, Qiu J (2016) Fifteen new earthworm mitogenomes shed new light on phylogeny within the Pheretima complex. Scientific reports 6: 20096. https://doi.org/10.1038/srep20096 Zhao H, Fan S, Aspe NM, Feng L Zhang Y (2022) Characterization of 15 Earthworm Mitogenomes from Northeast China and Its Phylogenetic Implication (Oligochaeta: Lumbricidae, Moniligastridae). Diversity 14: 714. https://doi.org/10.3390/d14090714 Zhao H, Han ACN, Liu M, Zhang Y, Aspe NM, Miao P, Wu D (2025) A new pheretimoid earthworm of the genus Metaphire Sims & Easton, 1972 (Oligochaeta, Megascolecidae) from northeastern China with data from the mitochondrial genome. Zoosystematics and Evolution 101: 81–89. https://doi.org/10.3897/zse.101.136027 Zhao Z, Peng Y, Wu Q, Yang Q, An N, Wu F, Yue K (2026) Distribution patterns and environmental drivers of soil fauna communities in China. Chinese Science Bulletin 71(16): 3779–3792. https://doi.org/10.1360/csb-2025-5709 Additional information Conflict of interest

The authors have declared that no competing interests exist.

 Ethical statement

No ethical statement was reported.

 Artificial Intelligence (AI) use

The authors accept full responsibility for the content of the manuscript, including the disclosure of any use of AI.

No AI tools were used in the preparation of this manuscript.

 Funding

This research was funded by the National Science and Technology Fundamental Resources Investigation Program of China (2024FY100400), and by International Joint Research Center for Invertebrate Biology in Hebei Province.

 Author contributions

Conceptualization and specimen collection & morphological identification, Qiao S. and Zhao H.; methodology and molecular experiments, Qiao S. and Zhang Y.; data analysis, mitochondrial genome assembly and phylogenetic analyses, Qiao S.; writing—original draft preparation, Qiao S., Zhang Y. and Zhao H.; writing—review and editing, Zhao H.

 Author ORCIDs

S. Qiao https://orcid.org/0009-0002-9964-1352

Y. Zhang https://orcid.org/0000-0002-4066-6355

H. Zhao https://orcid.org/0000-0003-4243-9671

 Data availability

All of the data that support the findings of this study are available in the main text or Supplementary Information.

 Supplementary materials 10.3897/subtbiol.57.196126.suppl1 A01A7809-0415-5C06-983B-FE80FA594883

Mitogenomes of Drawida xinjiangensis sp. nov. and Drawida wuxiensis

pdf

 https://binary.pensoft.net/file/1747525 This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Saiyu Qiao, Yufeng Zhang, Huifeng Zhao