Holotype : Spain • male; Canary Islands, La Palma, Cueva Honda de Miranda; 28.63744940, -17.78849367; 17 Oct. 2015; M. Naranjo leg. (50353 DZUL).

Cixius palmirandus is similar to the other cavernicolous Cixius species from La Palma, C. palmeros Hoch & Asche, 1993 and C. pinarcoladus Hoch & Asche, 1993 in habitus (degree of troglomorphy), body size, general configuration of the male genital morphology, but differs in several characters: upper portion of frons smooth (vs. pustulate as in C. palmeros and C. pinarcoladus), mesonotum with lateral carinae attaining posterior margin (unlike in C. palmeros), tegmen with Y-vein (Pcu, A1, Pcu + A1) complete (vs Y-vein incomplete in C. palmeros and C. pinarcoladus), genital styles with expanded distal portion highly elongate (vs spoon-shaped in C. palmeros and C. pinarcoladus), and aedeagus shaft ventrally with an obtuse ridge which is apically rounded, concave and distinctly curved ventrally (vs apically with an obtuse tip, as in C. palmeros, or directed straight caudally, as in C. pinarcoladus).

Habitus. Strongly troglomorphic with compound eyes absent, tegmina, wings and bodily pigmentation strongly reduced.

Body length. Male 3.9 mm (n = 1)

Colouration. Head, thorax and abdomen stramineous/yellowish, lateral carinae of head and lateral carinae of pronotum in anterior portion slightly darker. Antennae and legs whitish, tegmina translucent with costal vein yellowish, other veins unpigmented.

Head. Vertex short and wide, not separated from frons by a transverse carina, i.e., frons continuously rounded into vertex. Vertex laterally near posterior margin of head with two shallowly concave areas. Frons convex, in ventral view ca. twice as wide as medially long, smooth, without median carina, lateral carinae strongly ridged, directed laterally. Frontoclypeal suture highly vaulted. Post- und anteclypeus smooth, without median carina. Post- and anteclypeus together ca. 2.8 × longer than frons medially. Rostrum elongate, well surpassing hind coxae, 2^nd joint longer than 3^rd. Compound eyes and ocelli absent, the former position of the lateral ocelli faintly recognizable by a light roundish spot anteriorly of antennae. Antennae with scape very short, ring-like, pedicel globose, with sensory plaque organs feebly recognizable; antennae shielded anteriorly by lateral margins of frons.

Thorax. Pronotum short, ca. 4 × wider than medially long, and 1.5 × wider than maximum width of head; indistinctly tricarinate: median carina obtuse, lateral carinae distinct in anterior portion, diverging laterally, gradually vanishing; posterior margin of pronotum shallowly incised. Mesonotum slightly vaulted, ca. 1.3 × wider than medially long, in midline ca. 3 × the length of pronotum; tricarinate, with carinae obtuse and faintly recognizable, lateral carinae attaining posterior margin. Tegulae vestigial. Tegmina strongly reduced, venation as in Fig. 4. Costal vein in anterior and distal part of tegmen conspicuously wide; „Y-vein“ (Pcu, A1, Pcu + A1) preserved and recognizable. Tegmen ca. 1.6 × longer than maximally wide, attaining, respectively slightly surpassing posterior margin of third abdominal tergite. Longitudinal veins sparsely beset with bases of setae. Wings vestigial. Metatibiae laterally with 3 minute spines, distally with 6 teeth, grouped 5+1, lateral tooth longest. First and second metatarsal joints with 4 apical teeth, lateral ones longer than median ones. First metatarsal joint about as long as 2^nd and 3^rd joints together. Pretarsal claws slender, arolium small.

Figure 4. 

Cixius palmirandus Hoch & Naranjo, sp. nov. Habitus male (holotype). Scale bar: 0.5 mm.

Figure 5. 

Cixius palmirandus Hoch & Naranjo, sp. nov. Male genitalia (holotype) A genital segment, right lateral aspect B same, ventral aspect C anal segment, caudal aspect D anal segment, aedeagus, genital style, in situ, left lateral aspect E aedeagus, right lateral aspect F same, ventral aspect. Scale bar: 0.1 mm.

Male genitalia . Genital segment bilaterally symmetrical, in caudal aspect ca. 1.6 × higher than maximally wide, and in lateral aspect ca. 4 × longer ventrally than dorsally, caudal margins laterodorsally slightly expanding into rounded lobes, their margins beset with a cluster of long setae; medioventral process wide at base, distally tapering, tip in ventral view slightly incised, dorsal surface of medioventral process concave. Anal segment tongue-shaped, lateral margins straight, without ventral lobes, parallel from base to level of anal style, distally slightly tapering; anal segment distally of anal style bent ventrally in a ca. 45° angle, caudal margin produced into two short rounded lobes. Genital styles narrow in basal third, distally expanding, expanded portion elongate, distally rounded, medially concave; genital styles with dorsal margin of narrow portion and external surface of expanded portion densely beset with setae. Genital styles in repose joining in midline over nearly their whole length ventrally, nearly completely covering the aedeagus. Aedeagus with basal part (shaft) tubular, slender, slightly compressed in basal two thirds, ventrally near base with two small rigid spines directed caudally; shaft ventrally with an obtuse longitudinal ridge which is apically rounded and in upper part slightly curved ventrally. Shaft subapically with a bulbous projection dorsally and right laterally, shaft apically with two sturdy movable spinose processes: left lateral one shallowly S-shaped, tip in repose directed basally, right lateral one slightly shorter than left lateral one, strongly curved and in repose directed right-lateroventrally, its tip pointing right laterally. Distal part of aedeagus (flagellum) in repose bent dorsally, narrow, surpassing midlength of shaft, but not attaining base of shaft; dorsally with a longitudinal ridge which is produced into a short, stout spine at apex, tip of flagellum directed right laterally.

Female. Unknown.

The species epithet is an adjective in nominative singular, and a combination from the island of the type locality, La Palma, and the name of the cave, Cueva Honda de Miranda. The gender is masculine.

Known from the type locality in the east of La Palma, municipality of Breña Alta (Fig. 1). Endemic to La Palma.

Cueva Honda de Miranda is a lava tube located at 417 m a.s.l. in the eastern slope of the island. The potential vegetation in this area corresponds to a dry laurel forest (Visneo mocanerae-Arbutus canariensis sigmetum) (Del Arco and Rodríguez 2018). Currently, this space is occupied by agricultural plots and substitution scrub. The cave is a labyrinthic lava tube with over 20 galleries and 1 km of total development (Dumpiérrez et al 2000), in which seven troglobiont species have been recorded so far: the amphipod Palmorchestia hypogaea Stock & Martín, 1988, the isopod Halophiloscia microphthalma Taiti & López, 2008, the cockroach Loboptera fortunata Krauss, 1892, the thread-legged bug Collartida tanausu Ribes, Oromí & Ribes, 1998, and the beetles Licinopsis angustula Machado, 1987, Domene benahoarensis Oromí & Martín, 1990 and Laparocerus dacilae García, 1998. The gallery with the presence of C. palmirandus is located relatively close to the entrance to the cave, in which predominates a wide section, a high relative humidity and the presence of roots. The only specimen collected of C. palmirandus was dead but in good conditions for the formal descriptions of the new species. In this sector, an American cockroach nymph (Periplaneta americana) was observed, which may indicate local contamination by sewage.

Ecological classification . Cixius palmirandus sp. nov. displays several troglomorphic characters: absence of compound eyes and ocelli, strongly reduced tegmina and vestigial wings, and light body coloration. Although there is no information on the behaviour of the species, it is certainly unable to fly. The phenotypical configuration of eyes and wings suggests that it is restricted to the subterranean environment and likely to complete the entire life cycle underground. According to the criteria provided by Sket (2008), and more recently by Howarth and Moldovan (2018 a, b), we regard C. palmirandus sp. nov. as an obligate cavernicole, or troglobiont.

Cueva Honda de Miranda is located in an area of the island where the potential vegetation should be dry laurel forest (Del Arco and Delgado 2018), but it is currently heavily transformed into a rural environment dotted with scattered homes and agricultural fields. The sewage sanitation system in the area is non-existent, and wastewater is generally discharged directly into underground wells, which are gradually contaminating the subsurface. Additionally, the chemicals used in the fields also accumulate in the subterranean environment over the years. Under these circumstances, the underground habitat loses its suitability for native subterranean species, as they are very sensitive to such habitat alterations. Furthermore, with this degradation, the underground habitat begins to be colonized by invasive species that thrive in these types of contaminated environments, competing with and displacing the native subterranean fauna. The detection of Periplaneta americana (Linné, 1758) in some areas of Cueva Honda de Miranda is a clear indication that its subterranean environment is likely undergoing such environmental degradation process. Nevertheless, there is no regular monitoring of the subterranean species populations present in the cave, which would provide precise information on whether they are experiencing some decline (Rafael García, personal comment). The sporadic sampling conducted so far in the cave has allowed for the capture of the only known specimen of Cixius palmirandus sp. nov., but the lack of continuity in these sampling efforts does not allow us to determine whether this species is scarce due to being rare, due to naturally low populations, or because they have indeed suffered a decline due to the deterioration of the subterranean environment. According to the IUCN criteria for assessing whether a species falls into one of the threat categories on its Red List, Cixius palmirandus meets criterion D2 (see IUCN 2022) due to its very restricted area of occupancy, which is less than 20 km², and the fact that it is known from only one location. Such circumstances make this species highly vulnerable to the impacts of human activities and stochastic events in a short time frame, potentially leading to its classification as Critically Endangered or even Extinct in the near future. Given these conditions, this new species should be classified as Vulnerable according to the IUCN criteria.

The only known individual of this species, a male, was apparently collected and preserved in ethanol soon after the adult molt: the larval skin is still partially attached, and the cuticle still soft, thus the frons is distorted and the aristae of the antennae are missing. However, the male genital capsule appears to be fully sclerotized.

Holotype : Spain • male; Canary Islands, El Hierro, Municipality of Frontera, Camino de San Salvador, MSS; 27.73294972, -18.01168166; 28 Aug. 2007; H. López and P. Oromí leg. (IPNA). Paratype: Spain • female; same data as holotype (50354 DZUL).

Spain • 1 nymph III instar, 3 nymph IV instar; same data as holotype (IPNA).

Cixius theseus sp. nov. is similar to the other cavernicolous Cixius species from El Hierro, C. ariadne Hoch & Asche, 1993 and C. nycticolus Hoch & Asche, 1993 in habitus (degree of troglomorphy), body size, general configuration of the male and female morphology, but differs in several characters: Frons 2.3 × wider than medially high and not pustulate (vs. 1.5 × wider and pustulate in C. ariadne); tegmen with Y-vein preserved (vs. reduced in C. ariadne); in the male genitalia: caudal margin of anal segment medially incised (vs. rounded in C. ariadne), genital styles with distal expanded part dorsally rounded (vs. dorsally produced in C. ariadne), basal part of aedeagus (shaft) left laterally with a prominent longitudinal ridge (vs. without such a ridge in C. ariadne), and with bifurcate ventral projection slender (vs. wide in C. ariadne), right lateral subapical spinose process sturdy and in repose curved dorsally (vs. slender and in repose curved basally in C. ariadne) and, most prominently, distal part of aedeagus (flagellum) with a slender spinose process at ca. midlength (vs. without such a spinose process in C. ariadne); in the female genitalia: caudal margin of 7^th sternite medially expanding into an obtusely angulate process (as in C. nycticolus, vs. caudal margin straight in C. ariadne), and wax-secreting field on 9^th tergite medially separated by a narrow, longitudinal, membranous area (vs. wax-secreting field medially not separated but with a distinct median ridge in C. ariadne and C. nycticolus).

Figure 6. 

Cixius theseus Hoch & Aguín-Pombo, sp. nov. A habitus male (holotype) B habitus female (paratype). Scale bar: 0.5 mm.

Figure 7. 

Cixius theseus Hoch & Aguín-Pombo, sp. nov. (holotype). Male genitalia A genital segment, ventral aspect B anal segment, caudal aspect C left genital style, maximum aspect D anal segment, genital segment, aedeagus and genital style, in situ, left lateral aspect E aedeagus, left lateral aspect F same, ventral aspect G same, right lateral aspect. Scale bar: 0.1 mm.

Habitus . Strongly troglomorphic with compound eyes absent, tegmina, wings and bodily pigmentation strongly reduced.

Body length . Male 2.7 mm (n = 1). Female 3.3 mm (n = 1).

Colouration . Male. Head and thorax incl. legs light yellowish, lateral carinae of head and posterior margin of vertex brownish; antennae whitish; tegmina translucent, whitish, venation white-yellowish, veins beset with brownish setae; legs whitish, distal spines of hind tibiae and of metatarsal joints brownish; abdomen whitish, genital capsule slightly darker, yellowish brown. Female. Head with vertex light yellowish, frons yellowish, medially with a brownish longitudinal stripe; clypeus light brown; antennae yellowish with distinct reddish brown star-shaped sensory plaque organs; pronotum medially, i.e., between lateral carinae, yellowish, lateral portions slightly darker, yellowish brown; mesonotum light yellowish; tegmina translucent, venation whitish, beset with brownish setae; legs yellowish white; abdomen light yellowish, genital segment incl. ovipositor yellowish brown.

Head . Vertex short, ca. 3.5 × wider at base than medially long, very faintly separated from frons by an obsolete transverse carina. Frons convex, ca. 2.3 × wider than medially high, lateral carinae distinctly ridged and directed (antero-)laterally; frons smooth, without median carina, not pustulate. Frontoclypeal suture highly vaulted/arched. Post- and anteclypeus smooth, without median carina, together ca. 3.4 × longer than frons. Rostrum elongate, 2^nd joint longest; rostrum relatively shorter in the male: surpassing caudal margin of hind coxae only slightly, in the female with ca. half the length of 3^rd joint. Compound eyes and ocelli absent. Antennae with scape very short, ring-like, pedicel subcylindrical, ca. 1.4 × longer than wide, in the female with distinctly recognizable star-shaped sensory plaque organs.

Thorax . Pronotum faintly tricarinate, lateral carinae diverging laterally, gradually vanishing; pronotum ca. 1.8 × wider than maximum width of head, and 4.2 × wider than medially long, posterior margin concave, obtusely angulate. Mesonotum tricarinate, carinae only faintly recognizable, lateral carinae reaching posterior margin, median carina feeble, obtuse, vanishing caudally; mesonotum in the male 1.5 ×, in the female 1.4 × wider than medially long, and in midline 2.3 × longer than length of pronotum. Tegulae small. Tegmina strongly reduced, their caudal margin attaining ca. midlength of 3^rd abdominal tergite; tegmen longer than maximally wide: ca. 1.5 × in the male, and 1.65 × in the female; venation rudimentary, costal vein strong, basal cell closed, „Y-vein“ (Pcu, A1, Pcu + A1) preserved and recognizable, A1 and Pcu + A1 very close to posterior margin of tegmen; tegmina with numerous conspicuous setae along veins. Wings vestigial, very small.

Metatibiae laterally with 3 tiny spines, distally with 6 (in the male), and 6/7 (in the female) apical teeth, of which the lateral one is largest. First metatarsal joint in both sexes with 4, and second metatarsal joint with 4 (in the male) and ¾ (in the female) distal spines. First metatarsal joint about as long as 2^nd and 3^rd metatarsal joints together. Pretarsal claws slender, arolium small.

Male genitalia . Genital segment in caudal aspect slightly higher than wide, medioventral process simple, in ventral aspect obtusely angulate. Anal segment in dorsal aspect rectangular, ca. 2 × longer than wide, with distal portion slightly bent ventrally, lateral margins parallel, distal margin medially incised. Genital styles slender at base, distally expanding dorsally, expanded part medially concave. Aedeagus with basal part (shaft) slender, more or less tubular, left laterally with a prominent, longitudinal, rounded ridge and ventrally with a bifurcate projection directed basally. Shaft subapically on its right side with a sturdy movable spinose process which in repose is curved basally, its tip pointing dorsally. Distal part of aedeagus (flagellum) tubular, in repose bent dorsally and to right side, surpassing midlength of shaft, with a slender, spinose process, in repose directed basally, left laterally at ca. midlength of flagellum; visible part of ejaculatory duct rugose; phallotreme wide, located apically.

Female genitalia . 7^th sternite with anterior margin convex, highly vaulted cephally, rounded, caudal/posterior margin medially expanding caudally, expanded portion obtusely angulate. Ovipositor ensiform, slightly curved dorsally, caudally surpassing anal tube with less than 1/3 of its total length; anal segment tubular, short, in lateral view ca. 2 × higher than long, lateral margins more or less parallel; 9^th tergite caudally truncate, wax-secreting field distinctly limited, slightly concave, medially separated by a narrow, longitudinal membranous portion.

The species epithet is a noun in nominative singular and refers to Theseus, one of the heroes in Greek mythology, friend of Ariadne. The gender is masculine.

Adults known only from the type locality (Camino San Salvador), in the laurel forest in the huge landslide of El Golfo, at the northwest of El Hierro (Fig. 1). Endemic to El Hierro.

El Hierro is the youngest island in the Canary archipelago, and the youth of the terrain is visibly apparent in much of its territory. Fields of recent lava abound, and a large part of the soil is made up of volcanic deposits where fine ash or more or less coarse lava clinker predominate, or a mixture of both in highly variable proportions. In the central, western, and northern parts of the island, it is very common to find terrains formed by a layer of lava clinker covered by fine ash or an already formed, thin edaphic soil. The scoria layer contains a dense network of interstices and cracks (Fig. 2, top right), well isolated from changes in humidity and temperature from the outside by the overlying fine pyroclasts or soil covering it. This type of MSS was described for the first time in El Hierro and named as “volcanic MSS” (Oromí et al. 1986). Under these circumstances, the layer of pyroclasts maintains a high humidity level and a rather constant temperature throughout the year, which allows for the establishment of fauna adapted to subterranean life. This configuration of volcanic deposits constitutes the most common type of MSS in El Hierro, extending across large areas of the island. In Camino de San Salvador, where Cixius theseus n.sp. was discovered, the MSS was exposed when the terrain was cut to build a road (Fig. 2B). The location is in the laurel forest whose dominant trees are Morella faya (Aiton) Wilbur and Erica canariensis Rivas-Mart., Osorio and Wildpret, and herbaceous plants in the vicinity of the traps are Pericallis murrayi (Bornm.) B. Nord. and Urtica morifolia Poir. The traps were set over the talus of the road crossing the laurel forest, at 1230 m a.s.l. Although a good representation of the entire troglobiont fauna present on the island has been collected in nearby areas using MSS traps, only the capture of this new cixiid species should be noted in Camino de San Salvador.

Ecological classification . Cixius theseus displays a high degree of troglomorphy: compound eyes and ocelli absent, tegmina strongly reduced, vestigial wings as well as light, almost white body coloration. This blind and flightless species is most likely restricted to subterranean environments throughout its entire life cycle. According to the criteria provided by Sket (2008) and Howarth and Moldovan (2018 a, b) we regard Cixius theseus as an obligate cavernicole, or troglobiont.

Although only a few individuals of Cixius theseus are known, this new species apparently would not have conservation problems for several reasons: i) the volcanic MSS is widely distributed throughout the northern slope of the island, so habitat availability is not a limiting factor; ii) in general, this entire slope of the island with laurel forest is well-preserved and there are no houses that could be contaminating the subsurface with sewage; iii) since cixiids feed by sucking fluids from roots, the presence of laurel forest in high density across this area ensures a constant food supply. The initial results from the MSS traps in San Salvador showed very poor capture of troglobitic species, which led us to their deactivation soon, a reason why very few specimens of this new species are known. However, Cixius theseus also clearly meets criterion D2 as in the case of Cixius palmirandus, so it should be classified as Vulnerable according to the IUCN criteria.

From the type locality, 4 unpigmented, eyeless cixiid nymphs (III. and IV. instar) were collected, which are here preliminarily identified as C. theseus sp. nov. (IPNA). Morphologically very similar nymphs have been recorded from another locality („Mercader, MSS4; 27 Jan. 2012; H. López leg.“ and „Mercader, MSS3; 18 Jun. 2012; P. Oromí and H. López leg.“), 1075 m a.s.l. (27.71294456, -18.02217521), on the southern slope of the island, 2.3 km far from San Salvador. Whether these are conspecific with C. theseus cannot be confirmed on the basis of morphological characters alone. It remains to be investigated whether C. theseus sp. nov. is more widely distributed on El Hierro.

Holotype : Spain • male; Canary Islands, La Gomera, Reventón Oscuro, MSS T3; 28.12468504, -17.21638908; 2 Jan. 2012; P. Oromí leg. (50355 DZUL).

Paratypes : • Same data as holotype, except • 1 male, 1 female; 5 Feb. 2009; P. Oromí and H. López leg. (34924 DZUL) • 1 male (6962 DZUL), 2 males (7014 DZUL), 3 males (7074 DZUL); 30 Jun. 2009; P. Oromí and H. López leg. • 1 male; 1 Jul. 2009; P. Oromí and H. López leg. (34935 DZUL) • 2 males; T3; 4 Jan. 2010; P. Oromí leg. (7009 DZUL) • 1 female; 8 Jun. 2010; P. Oromí and H. López leg. (UMACI) • 1 male, 1 female; T1; 9 Jan. 2011; P. Oromí and H. López leg. (UMACI) • 1 male, 3 females; T1; 30 Jul. 2011; P. Oromí leg. (IPNA) • 1 male, 1 female; T3; 2 Jan. 2012; P. Oromí leg. (7038 DZUL) • 1 male, 1 female; T3; 26 Mar. 2015; P. Oromí leg. (UMACI) • 1 female; 17 Sep. 2015; P. Oromí leg. (DZUL) • 1 male; 31 Jul. 2024; P. Oromí leg. (IPNA: BC3166).

• Same data as holotype, except • 3 nymphs V instar (6962 DZUL), 4 nymphs V instar; T1; 30 Jul. 2009; P. Oromí and H. López leg. (UMACI) • 3 nymphs V instar and 1 nymph IV instar; T3; 4 Jan. 2010; P. Oromí leg. (UMACI) • 1 nymph V instar and 1 nymph IV instar; T3; 8 Jul. 2010; P. Oromí and H. López leg. (UMACI) • 1 nymph V instar; 9 Jan. 2011; P. Oromí and H. López leg. (UMACI) • 1 nymph V instar; T1; 30 Jul. 2011; P. Oromí leg. (IPNA: BC2984) • 2 nymphs IV and V instar; T3; 2 Jan. 2012; P. Oromí leg. (IPNA: BC2982, BC2983) • 1 nymph V instar; T1; Jun. 2013; P. Oromí leg. (UMACI) • 2 nymphs III and IV instar; T1-4; 17 Nov. 2013; P. Oromí leg. (IPNA: BC2985, BC2986) • 1 nymph V instar; 17 Sep. 2015; P. Oromí leg. (UMACI) • 1 male; 31 Jul. 2024; P. Oromí leg. (IPNA: BC3165).

T1, T2, T3 are the different MSS traps set along ca. 100 m in the same location.

In general appearance and in the overall configuration of male and female genital structures Tachycixius gomerobscurus sp. nov. ressembles T. crypticus and T. retrusus from Tenerife, but differs in the following characters: shape of vertex: vertex short, anterior margin very shallowly rounded (vs strongly convex towards frons in T. crypticus and T. retrusus); colouration of tegmina: less vividly coloured than in T. crypticus and T. retrusus; reduction of hind wings much stronger than in T. crypticus and T. retrusus; male genitalia: caudal margin of anal segment medially strongly concave (vs shallowly concave in T. crypticus and straight in T. retrusus); shaft of aedeagus with 3 subapical movable spines (vs. 2 such spines in T. crypticus and T. retrusus); female genitalia: 9^th tergite medioventrally deeply incised, membranous excavation acutely triangular (vs 9^th tergite medioventrally only shallowly incised, membranous excavation dorsally shallowly rounded in T. crypticus and T. retrusus); 9^th tergite with wax-secreting field medially with a short, but distinct median ridge (vs without such a ridge in T. crypticus and T. retrusus).

Habitus . In general appearance resembling Tachycixius crypticus Hoch & Asche, 1993 and T. retrusus Hoch & Asche, 1993 from Tenerife, although less vividly coloured; weakly troglomorphic (i.e. hypogeomorphic, see Deharveng and Bedos 2018): compound eyes present, but small, tegmina covering most of the abdomen but not attaining tip of anal tube in the male, respectively tip of ovipositor in the female; hind wings strongly reduced, vestigial.

Figure 8. 

Tachycixius gomerobscurus Hoch & Oromí, sp. nov. A habitus male B head and thorax, dorsal aspect.

Body length . Male 3.8–4.05 mm (n = 4). Female 4.3–5.2 mm (n = 6).

Colouration . Vertex, frons and head laterally light yellowish, with lateral carinae of vertex and frons and posterior margin of vertex slightly darker; antennae (pedicel) whitish; compound eyes reddish-dark brown; pro- and mesonotum light yellowish, otherwise thorax incl. Legs whitish, tips of lateral and distal spines of tibia, as well as distal spines of first and second metatarsal joints dark brown. Tegmina translucent, light yellowish, venation whitish, bases of setae along veins and margin of tegmen slightly darker, brownish; tegmen with anterior portion of triangle formed by cubitus posterior (CuP) and posterior margin of tegmen profusely brownish, and three irregularly limited, faint fuscous transverse bands: one at level of tegmen midlength, one at level of pterostigma, and one more or less parallel to distal margin (see remarks). Abdomen incl. genitalia light yellowish, or yellowish-brown, respectively.

Figure 9. 

Tachycixius gomerobscurus Hoch & Oromí, sp. nov. Right tegmen (male). For meaning of arrow see text. Scale bar: 0.5 mm.

Head . Vertex short, about 3.5 × wider at base than medially long, anteriorly rounded, with a faint median carina, areolets small, slightly concave, medially separated by an obtuse median carina; vertex indistinctly separated from frons by an obsolete transverse carina. Frons 1.2 × wider than medially high, with a distinct median carina, lateral carinae foliately produced laterally. Post- and anteclypeus with an obtuse median carina; together ca. 1.5 × longer than frons. Frontoclypeal suture strongly arched. Compound eyes present, compared to epigean Tachycixius species reduced in relative size, pigmented, lateral ocelli distinct, median frontal ocellus rudimentary. Rostrum elongate, well surpassing hind coxae, in males attaining anterior margin of 9^th abdominal segment, in females attaining level of caudal margin of 9^th tergite. Antennae with scape short, ring-like, and pedicel cylindrical, ca. 1.4 × longer than wide, with sensory plaque organs arranged in several rows.

Figure 10. 

Tachycixius gomerobscurus Hoch & Oromí, sp. nov. Male genitalia A genital segment, caudal aspect B same, ventral aspect C anal segment, caudal aspect D left genital style, maximum aspect E anal segment, genital segment, aedeagus and genital styles, in situ, left lateral aspect F aedeagus, right lateral aspect G same, ventral aspect. Scale bar: 0.1 mm.

Thorax . Pronotum tricarinate, lateral carinae ridged and diverging laterally near posterior margin of pronotum; pronotum short, medially ca. 1.8 × longer than vertex, and 1.7 × wider than maximum width of head (incl. compound eyes), posterior margin concave, medially forming an obtuse angle. Mesonotum tricarinate, carinae faint, lateral carinae attaining posterior margin of mesonotum; mesonotum 1.2 × wider than medially long, and medially 3.2 × longer than pronotum. Tegulae small. Tegmina distally reduced, in both sexes attaining caudal margin of anal segment, ca. 2.5 × longer than maximally wide; venation well developed, variable among specimens (in all specimens studied except for 1 female, the CuP vein does not connect to posterior margin of tegmen as is the case for most Cixiidae, but merges with PCu + A1 (= common stem of Y-vein, see Fig. 6, arrow), see remarks; basal cell closed, pterostigma faintly recognizable; veins beset with or accompanied by numerous conspicuous bases of setae, on distal margin also between veins. Hind wings very small, vestigial, not surpassing posterior margin of metanotum. Metatibiae laterally in the majority of specimens studied with 3 small spines (variation: configurations 4/3 and 3/2 were observed in one female each), distally with 6 sturdy spines (in one female with 7 spines on one leg) (arranged in a row, lateral one strongest); metabasitarsus distally with 7–8 (bilaterally and individually variable), 2^nd metatarsal joint distally with 7–8 spines (bilaterally and individually variable), each of the median 4 bearing one macroseta. Metabasitarsus slightly longer than 2^nd and 3^rd metatarsal joints together. Pretarsal claws short, stout, arolium small.

Male genitalia . Genital segment in caudal view ca. 1.3 × higher than wide, and in lateral view ventrally ca. 4.6 × longer than dorsally, caudal margins laterodorsally produced into 2 rounded lobes directed laterocaudally; medioventral process slender, triangular, dorsal surface with a faint median ridge. Anal segment elongate, narrow, in distal third bent ventrocaudally, in dorsal view ca. 2 × longer than wide at base, lateral margins in dorsal view more or less parallel, caudally of anal style converging, distal margin broadly rounded, ventral portion distally of anal style in caudal aspect strongly vaulted, with caudal margin medially concave; anal style elongate, slender. Genital styles narrow at base, distal third expanding dorsally, expanded portion caudally rounded, dorsally with an obtuse angle, medially concave. Aedeagus. Basal part of aedeagus (shaft) in proximal half wide, with three more or less compressed velum-like projections: one left laterally, extending from base to ca. midlength of shaft, one ventrally which is wide at base, narrowing at ca. midlength of shaft and extending from base almost to apex, and one right laterally which is broadly rounded and directed right laterocaudally. Shaft in distal half on right side with a compressed lobe extending right laterally, and subapically with 3 sturdy movable spinose processes: one left laterally, in repose curved dorsally, one ventrally, in repose directed basally, its tip pointing left laterally, and one right laterally, which is double-S-shaped, in repose curved basally and to right side. Distal portion of aedeagus (flagellum) well surpassing midlength of shaft, medially almost rectangularly bent and directed right laterally; without any spinose processes; distal portion of flagellum on ventral side expanding into a lobate, rounded protrusion, visible part of ejaculatory duct rugose, phallotreme wide, exposed dorsally.

Female genitalia . Seventh sternite subtriangular, anterior margin broadly rounded, caudal margin medially straight; ovipositor ensiform, slightly curved dorsally, caudally slightly surpassing anal segment; anal segment tubular, short, stout, dorsoventrally only slightly depressed; ninth tergite caudally truncate, wax-secreting field indistinctly limited, shallowly concave, with a short, but distinct median ridge; 9^th tergite medioventrally deeply incised, membranous excavation acutely triangular, attaining dorsal third of 9^th tergite.

The species epithet is an adjective in nominative singular and a combination of Gomera and oscuro, the Spanish word for dark, probably used to create the toponym of this shadowy location inside the laurel forest. The gender is masculine.

Known only from the type locality, Reventón Oscuro, municipality of Hermigua, in Garajonay National Park (Fig. 1). Endemic to La Gomera.

The MSS in Reventón Oscuro and in other places of Garajonay National Park is of the colluvial type, originated by accumulation of stone fragments at the base of rocky walls, and covered over time by soil (Juberthie et al. 1980, Mammola et al. 2016). The three traps set in Reventón Oscuro are on a steep slope inside a dense, humid and moderately dark laurel forest at 1035 m a.s.l. with a thin but rich organic soil covering the colluvium. All traps were set very close to tree trunks in order to protect them from gravitational collapse, and the colluvium was rich in small roots throughout its sampled depth (70–80 cm). La Gomera is the only island of the archipelago without lava tube caves due to the absence of volcanism in the last 2.5 Ma, but the MSS in the laurel forest is rich in troglobionts (Medina and Oromí 1990, Pipan et al. 2010, Gilgado et al. 2011, García et al. 2020). In this sense, Reventón Oscuro is the most diverse (13 species) among all Canary Island’s MSS stations, as well as the most abundant in individuals (PO, HL unpublished data).

Ecological classification . Tachycixius gomerobscurus displays several troglomorphic characters, although not as strongly as Tachycixius lavatubus Remane & Hoch, 1988, Cixius palmirandus or C. theseus: the integument shows remnants of brownish pigmentation, the compound eyes are reduced in size, yet present, and ommatidia are pigmented; the lateral ocelli are distinct, the frontal ocellus is rudimentary. The tegmina are reduced distally, and hind wings are vestigial, much shorter than in the other MSS-dwelling species T. crypticus and T. retrusus. Although there are no observations on the behaviour of the species, we assume that individuals are unable to fly, but may be able to perceive visual input. As T. gomerobscurus has been collected from traps in the MSS, and given the presence of reduced but pigmented eyes, little is known about its behaviour. Despite its comparatively mild degree of troglomorphy, we assume that T. gomerobscurus is restricted to subterranean environments, and we therefore regard it preliminarily as an obligate hypogeomorphic troglobiont.

Over the past 15 years, nearly 40 individuals (both adults and nymphs) of this new species have been collected using MSS traps baited with liver or blue cheese. These individuals probably fell into the traps by chance rather than being attracted to the bait, as these planthoppers feed by sucking fluids from roots. The MSS site of Reventón Oscuro is the location in the Canary Islands where we have captured the largest number of troglobitic planthoppers using MSS traps, and the number of captures has remained relatively constant over the years. All evidence suggests that this species likely has a high density of individuals in this area. The region where this new species has been collected is a very well preserved national park, where a dense laurel forest ensures a consistent food supply in the subterranean habitat (roots). The limited known distribution of T. gomerobscurus on La Gomera is primarily due to the scarce sampling performed in the MSS at other sites on the island, being uncertain whether or not it has a broader distribution. However, although this species lives in a well-preserved habitat where it could apparently have a good population size, the IUCN recommends classifying it as Vulnerable according to criterion D2, since only one population is known distributed in a small area, which could completely disappear or enter a higher threat category if such a limited area were suddenly affected by impacts of human activities and/or stochastic events.

The peculiar venation pattern observed in all but one specimens studied (the CuP merging with PCu + A1, i.e., the common stem of the „Y“ -vein instead of connecting to the posterior margin of tegmen) is very unusual not only for Cixiidae, but the Fulgoromorpha. It is likely a mutation in connection with the distal reduction of the tegmen, which has affected the overall venation pattern.

Some variation is observed in the colouration of body and tegmina: 2 specimens, 1 male and 1 female (coll. 2 Jan. 2012; T3) show very weak pigmentation of body and tegmina, and appear to have freshly molted into adult.

Holotype : Spain • male; Canary Islands, El Hierro, Cueva de Guinea; 27.77448369, -17.99866804; 22 Mar. 2021; H. López and C. Andújar leg. (IPNA). Paratypes: Spain • 2 males, 10 females; same data as holotype; (1♂ 50356 DZUL; 3♀ 50357, 50358, 50359 DZUL; 1♂7♀ IPNA).

Spain • 14 nymphs IV instar, 5 nymphs V instar; same data as holotype; (16 nymphs DZUL; 3 nymphs (IPNA: BC1267, BC1268; BC1269)).

Meenoplus skotinophilus is similar in general appearance and degree of troglomorphy to Meenoplus claustrophilus from La Palma, but differs from this species by the distally stronger reduced tegmina and lighter overall pigmentation. From the other two cavernicolous Meenoplus species on El Hierro (M. cancavus und M. charon), it differs distinctly by its degree of troglomorphy (compound eyes present, tegmina and wings well developed, tegmina surpassing tip of abdomen). While the general configuration of the male and female genitalia is similar in all four species (M. claustrophilus, M. skotinophilus, M. cancavus und M. charon), Meenoplus skotinophilus differs from these by the following characters of the male genitalia: ventrocaudal lobes of anal segment with median tips subacute and well separated (vs rounded and nearly apposed in the other species), aedeagus with apical margins of phallotreme angulate (vs rounded in the other species), and of the female genitalia: ventral valvulae distally with a beak-shaped, sturdy and acute tip pointing mediad (vs bearing a minute tip), and with proximal portion broadly lobate and finely serrate (vs rounded and smooth in the other species).

Figure 11. 

Meenoplus skotinophilus Hoch & López, sp. nov. A head and thorax, dorsal aspect B head, ventral aspect. Scale bar: 0.5 mm.

Habitus . Troglomorphies weakly defined except for compound eyes and pigmentation, tegmina and wings well developed, in repose surpassing the tip of the abdomen. In general appearance, intermediate between epigean Meenoplidae and strongly troglomorphic species, such as e.g., Meenoplus cancavus Remane & Hoch, 1988 and M. charon Hoch & Asche, 1993.

Figure 12. 

Meenoplus skotinophilus Hoch & López, sp. nov. A tegmen B wing. Scale bar: 0.5 mm.

Body length . Male 2.8–2.9 mm (n = 3). Female 3.2–3.5 mm (n = 6).

Colouration . Head, pro- and mesonotum as well as male and female genitalia yellowish-brown, otherwise thorax und pregenital abdomen white. Compound eyes red. Tegmina translucent, pale stramineous in males, light brown in females; venation as well as areas along veins and between sensory pits yellowish-brown. Wings hyaline, venation yellowish-brown. Legs stramineous, apical spines of tibia and tarsal joints I –II, light brown.

Figure 13. 

Meenoplus skotinophilus Hoch & López, sp. nov. Male genitalia A genital segment, caudal aspect B anal segment dorsal aspect C same, caudal aspect D left genital style, ventral aspect E anal segment, genital segment, aedeagus, genital style, in situ, left lateral aspect F aedeagus, ventral aspect G aedeagus, caudal aspect, view on phallotreme. Scale bar: 0.1 mm.

Head . Vertex very short, ca. 12 times wider than medially long, distinctly separated from frons by a ridged transverse carina. Frons strongly convex, anterior portion bulbous, about as wide as medially high, at and below level of antennae with a short row of small and hardly visible sensory pits irregular in number (4–6). Lateral carinae of frons foliately ridged and directed anterolaterad, anteriorly with a distinct row of large sensory pits; lateral lamelliform carinae continuing onto postclypeus. Frons smooth, without median carina, postclypeus shallowly, anteclypeus steeply vaulted. Compound eyes small, lateral ocelli vestigial, median frontal ocellus strongly reduced, ist former position marked by a light circular spot at the lower portion of the frontal bulbous area. Scape short, ring-like, pedicel cylindrical, ca. 1.7 times longer than wide.

Figure 14. 

Meenoplus skotinophilus Hoch & López, sp. nov. Female genitalia A left lateral aspect B caudal aspect. Scale bar: 0.1 mm.

Thorax . Pronotum medially about 3.5 times the length of vertex, posterior margin obtusely angulate; pronotum weakly tricarinate, median carina very feeble. Tegulae, tegmina and wings well developed; tegmina distally surpassing tip of abdomen with ca. 1/5 their total length. Tegmen with rows of sensory pits along the distal part of the costal vein, along ScP+R (+Ma), RP (+MA) and along PCu, A1, and their common stem PCu + A1 („Y-vein“). Metatibiae laterally unarmed, with 8 apical teeth. First metatarsal joint with 7 apical teeth, second metatarsal joint with 6 apical teeth.

Male genitalia . Genital segment in lateral aspect ventrally ca. 3 times as long as dorsally. Anal segment distally produced into two ventrocaudal lobes which converge medially, their median tips subacute and well separated from each other. Genital styles slender, narrow throughout, apically rounded, gently curved dorsad. Aedeagus tubular, stout, with phallotrema apically and dorsocaudally exposed, apical margins dorsally bluntly angulate.

Female genitalia . Strongly reduced, ventral valvifers produced into a rounded lobe; ventral valvulae with distal portion „bird-head-shaped“, i.e., caudally rounded and medially with an acute tip pointing mediad, and with proximal portion broadly lobate, with median margin straight and finely serrate, apposed.

Molecular identification . Mitochondrial COI barcode sequences of 635 pb were obtained for three individuals of Meenoplus skotinophilus (specimen codes BC1267, BC1268 and BC1269). These individuals have identical barcode sequences, so no interpopulation genetic divergence has been detected. Either in BOLD or GenBank, no matches with similarity values greater than 85% were detected, so the genetic information that we supply is actually new for the genetic lineage of the group of species that may belong Meenoplus skotinophilus. The sequences were deposited in GenBank (accession numbers PQ530856, PQ530856 y PQ530856), with the following base composition:

AATGAGCCAGATTAATAGGTATAACAAGAAGAATAATTATTCGAATTGAATTAATACAACCTGGTTCA
ATAATTAAAAATGATCAAATTTATAACTCAATTGTTACATCACATGCATTCATTATAATTTTTTTTTCA
GTTATACCCATCCTAATCGGTGGATTTGGAAATTGACTTGTACCTCTAATGATTGGAGCACCTGATAT
AGCATTCCCACGAATAAACAATATAAGCTTCTGAATATTACCTCCATCACTAATACTATTAATTTTCA
GTTCATTTTCAGGTTCAGGTACAGGTACAGGATGAACAATTTATCCACCATTATCAAGAATTCCTGCA
CATTCTGGCCCATCTACTGACTTATCTATCTTTTCCCTTCATATAGCAGGTGTAAGATCAATTCTAGG
AGCAATTAATTTCATTTCAACTATTATTAATATACGACCTAAAATAATAACAATAGAAAAAATACCCC
TATTTTGCTGATCAATTTTCATTACAGCAATTTTACTTCTTCTATCATTACCTATTCTTGCAGGAGCA
ATTACTATACTATTAACTGATCGAAACTTTAATACATCATTTTTTGATCCAACAGGAGGAGGAGACCC
TATTTTATATCAACATTTATTT

The species epithet is an adjective in nominative singular and a combination of the Greek words „skótos“ (= darkness) and „phílos“ (= friend). The gender is masculine.

The species is kown only from the type locality, Cueva de Guinea, municipality of Frontera (Fig. 1). Endemic to El Hierro.

Meenoplus skotinophilus has been discovered in a lowland area of Frontera with a wide lava flow seemingly originating from the base of Tibataje cliff and extending towards the sea. The point from which the lava flow emerged is apparently clear, but no volcanic cone can be seen there, probably being buried under abundant sediment dragged from the cliff. In the upper part of the lava flow, close to the cliff, there is a complex of lava tubes, mostly unconnected but clearly formed during this eruption. One of them is Cueva de Guinea, a hardly 25 m long lava tube with a small entrance on the roof. At first the floor is rocky with scattered stones fallen from the ceiling, while in the last wider room clayish sediments cover the original substrate. The humidity is high and there are many roots attached to the walls and hanging from the ceiling. All this creates a good environment for the establishment of a community of invertebrates with some troglobitic species, like blind weevils and spiders, actually under study, besides a rich population of Meenoplus skotinophilus n. sp. around the roots. Also, American cockroaches (Periplaneta americana) were observed, both living specimens and remains. Outside the cave the vegetation is typical of dry areas and lava flows at low altitudes, where Euphorbia lamarckii Sweet, Schizogyne sericeae (L. f.) DC. and Rumex lunaria L. predominate.

Ecological classification. Meenoplus skotinophilus displays several troglomorphic characters, such as small compound eyes, reduced ocelli, and light, yellowish-white body coloration. Tegmina are reduced distally, but wings are well developed. Although there are no observations on the behaviour of the species, we assume that individuals may be able to perceive some visual input, and may have retained the ability of some, even if not sustained flight. According to the degree of troglomorphy, we assume that Meenoplus skotinophilus is restricted to subterranean environments, and we therefore regard it preliminarily as an obligate cavernicole or troglobiont, but of the hypogeomorphic type.

The area surrounding the cave entrance is part of an archaeological complex transformed into an open-air ecomuseum, which features reconstructed homes of the island’s earliest inhabitants as well as those of later colonizers. The site also includes a center for the rehabilitation of an endangered endemic giant lizard and a natural cave that has been adapted for tourist visits. The volume of visitors is significant, and all facilities are equipped with bathrooms without connection to a sewage system, the wastewater being discharged directly into underground wells. This practice gradually contaminates the underground environment, promoting the colonization of invasive species such as Periplaneta americana in both Cueva de Guinea and the nearby showcave. The deterioration of the subterranean environment poses a potential threat to native subterranean fauna, which may either be displaced by invasive species or find their habitat unsuitable for survival. However, in the only sampling conducted in Cueva de Guinea Meenoplus skotinophilus was found abundantly, apparently with no serious threats at that time. To accurately apply the IUCN evaluation criteria to this species, it is essential to monitor its population in the short- to medium-term to determine whether it is indeed declining due to the aforementioned threats. However, M. skotinophilus should be included in the Vulnerable category based on IUCN criterion D2. In this case this is well justified given the intense tourist activity in the location where the only known population of this new species is found, being expected a strong negative pressure on its conservation in the short-medium term.

Some nymphs of this new species have been selected for an ongoing genetic study with the aim of understanding the phylogenetic relationships between the three endemic species of Meenoplus present in El Hierro. This is a striking situation since it implies multiple speciation in the subterranean environment of a geologically very young island (1.12 Ma) in contrast to the absence of this genus on more mature islands rich in underground environments, such as Tenerife.