Research Article
Print
Research Article
Mitochondrial sequence data indicate “Vicariance by Erosion” as a mechanism of species diversification in North American Ptomaphagus (Coleoptera, Leiodidae, Cholevinae) cave beetles
expand article infoVincent L. Leray, Jason Caravas§, Markus Friedrich§, Kirk S. Zigler
‡ The University of the South, Sewanee, United States of America
§ Wayne State University, Detroit, United States of America
† Deceased author
Open Access

Abstract

Small carrion beetles (Coleoptera: Leiodidae: Cholevinae) are members of cave communities around the world and important models for understanding the colonization of caves, adaptation to cave life, and the diversification of cave-adapted lineages. We developed a molecular phylogeny to examine the diversification of the hirtus-group of the small carrion beetle genus Ptomaphagus. The hirtus-group has no surface-dwelling members; it consists of 19 short-range endemic cave- and soil-dwelling species in the central and southeastern United States of America. Taxonomic, phylogenetic and biogeographic data were previously interpreted to suggest the hirtus-group diversified within the past 350,000 years through a series of cave colonization and speciation events related to Pleistocene climate fluctuations. However, our time-calibrated molecular phylogeny resulting from the analysis of 2,300 nucleotides from five genes across three mitochondrial regions (cox1, cytb, rrnL-trnL-nad1) for all members of the clade paints a different picture. We identify three stages of diversification in the hirtus-group: (1) ~10 million years ago (mya), the lineage that develops into P. shapardi, a soil-dwelling species from the Ozarks, diverged from the lineage that gives rise to the 18 cave-obligate members of the group; (2) between 8.5 mya and 6 mya, seven geographically distinct lineages diverged across Kentucky, Tennessee, Alabama and Georgia; six of these lineages represent a single species today, whereas (3) the ‘South Cumberlands’ lineage in Tennessee and Alabama diversified into 12 species over the past ~6 my. While the events triggering diversification during the first two stages remain to be determined, the distributions, phylogenetic relationships and divergence times in the South Cumberlands lineage are consistent with populations being isolated by vicariant events as the southern Cumberland Plateau eroded and fragmented over millions of years.

Keywords

Cumberland Plateau, speciation, microphthalmy, troglobiont, biodiversity hotspot

Introduction

Lacking light and typically low in energy resources, caves represent a challenging environment to adapt to. In spite of these challenges, subterranean habitats harbor communities of taxonomically diverse species assemblages. The small carrion beetles (Coleoptera: Leiodidae: Cholevinae) are a significant component of cave biodiversity in temperate regions, having colonized caves on numerous occasions worldwide (Peck 1973, Ribera et al. 2010, Fresneda et al. 2011). Cave-adapted species that have reduced eyes (microphthalmy) or are eyeless (anophthalmy) have evolved many times in the family (Fig. 1) (e.g. Peck 1973, Fresneda et al. 2011, Peck and Wynne 2013).

Figure 1. 

Eye morphologies in Ptomaphagus. Lateral view of head capsule and compound eye or eyelets (arrowheads) of Ptomaphagus species discussed in this paper. Ptomaphagus cavernicola and P. consobrinus are macrophthalmic and were used as outgroups in this study. Ptomaphagus shapardi, the only soil-dwelling species in the hirtus-group, has reduced eyes and is considered microphthalmic. The other 17 members of the hirtus-group are extremely microphthalmic.

As common and speciose cave inhabitants, leiodid beetles can provide insights into the colonization of caves, adaptation to cave life, and the diversification of cave-adapted lineages. Recent molecular work on a Palearctic radiation of subterranean leiodids (Leiodidae: Cholevinae: Leptodirini) provided insight into the timing of cave colonization, life history evolution, and diversification in the group (Ribera et al. 2010, Fresneda et al. 2011, Rizzo et al. 2013, Cieslak et al. 2014, Njunjić et al. 2018). Using a molecular clock calibrated by the tectonic separation of the Corso-Sardinian plate, Ribera et al. (2010) showed this was an ancient invasion of cave habitats, with the earliest subterranean lineages diverging in the Oligocene, around 30 million years ago (mya). They also traced subsequent evolution within the group, uncovering continued life-history evolution and diversification post-cave invasion (Cieslak et al. 2014).

Studies of leiodid beetles have also provided insight into the molecular changes associated with cave adaptation. The first transcriptome study on a cave species, the Nearctic leiodid Ptomaphagus hirtus (Leiodidae: Cholevinae: Ptomaphagini), revealed the conservation and expression of all genes known to be specifically required for phototransduction despite an extreme reduction of the visual system (Fig. 1). This observation was complemented by light-dark choice tests, which uncovered a strong negative photoresponse in P. hirtus (Friedrich et al. 2011). In addition, the conservation of circadian clock gene expression and the loss of expression of several genes in the ommochrome eye pigmentation pathway were observed (Friedrich et al. 2011).

The genus Ptomaphagus (subgenus Adelops) has been described as the most ecologically versatile group of New World Leiodidae (Peck 1973). Peck (1973) divided Adelops into the hirtus-, consobrinus- and cavernicola-groups. Most members of the consobrinus- and cavernicola-groups are fully eyed (macrophthalmic), winged, and have large distribution ranges. Various lineages within all three groups are either facultative cave dwellers (eutroglophiles) or obligatory cave dwellers (troglobionts) (Sket 2008, Peck and Newton 2017). The trend toward cave-dwelling is most pronounced in the 19 species of the hirtus-group. Distributed across the central and southeastern United States of America, the hirtus-group is the largest Nearctic clade of cave-adapted Leiodidae (Peck 1973, 1984, 1986). With the exception of one soil-dwelling eutroglophile, all hirtus-group species are troglobionts, exhibiting extreme reduction and reorganization of the ancestral compound eye state to miniaturized camera-type eyelets (microphthalmy) and loss of wings (Fig. 1) (Peck 1973).

Members of the hirtus-group are found in four ecoregions (Omernik 1987): the Ridge and Valley, the Southwestern Appalachians, the Interior Plateau, and the Ozarks. Ptomaphagus shapardi, the soil-dwelling eutroglophile, is found in Arkansas and Oklahoma. The other species are troglobionts. Ptomaphagus hirtus is found in the Mammoth Cave region of central Kentucky, two species (P. barri and P. hubrichti) are found in central Tennessee, two species (P. fiskei and P. whiteselli) are found in northwest Georgia and one species (P. walteri) is known from the southern end of the Sequatchie Valley in Alabama. The other twelve hirtus-group species are clustered in the southern Cumberland Plateau of south-central Tennessee and northeast Alabama (Fig. 2A, B; Peck 1973).

Figure 2A. 

Distribution of hirtus-group species. All known sites for hirtus-group species in Kentucky, Tennessee, Alabama, and Georgia. P. shapardi sites in Oklahoma and Arkansas are indicated in upper right inset map. A dozen species from the southern Cumberland Plateau in Tennessee and Alabama are combined.

Figure 2B. 

Distribution of hirtus-group species. All known sites for members of the South Cumberlands lineage in Tennessee and Alabama. Exposed karst is shown in gray.

As is typical for cave species, all hirtus-group species have small ranges. With distribution ranges <10,000 km2, all 18 cave-obligate hirtus-group species are short-range endemics (Harvey 2002). Indeed, many are extreme short range endemics (Niemiller et al. 2017) with species ranges <100 km2. Half of the hirtus-group species are known from five or fewer caves (Peck 1973).

Using morphological characters, Peck (1973, 1984) developed a phylogenetic framework of Adelops and hirtus-group diversification but left many relationships unresolved. Based on a lack of sympatry between hirtus-group species and the presence of microphthalmic eyes (as opposed to anophthalmy), Peck hypothesized that the hirtus-group invaded caves and diversified recently. In a version of the Climatic Relict Hypothesis (reviewed in Culver and Pipan 2009), he suggested that glacial-interglacial cycles of the Pleistocene led to the isolation and diversification of most hirtus-group species over the last 350,000 years (Peck 1973, Peck 1984). Peck (1984) further hypothesized that Ptomaphagus populations retreated to cave- or cave-like habitats during warm and dry interglacial periods, eventually becoming cave-limited and, as a consequence, ultimately reproductively isolated. Following Peck (1984), the hirtus-group has been noted as an example of the Climatic Relict Hypothesis in the literature (e.g. Culver and Pipan 2009). The timing of Peck’s (1984) scenario for the diversification of the hirtus-group (over the past ~350,000 years during the middle and late Pleistocene) differs markedly from divergence times subsequently estimated by molecular clock dating approaches for the European cave-dwelling Leiodidae, where most congeners diverged in the Pliocene or Miocene, as long as 15 million of years ago (Ribera et al. 2010).

Confronted with these divergent models for the timing of diversification in palearctic vs. nearctic cave-dwelling Leiodidae we investigated the diversification of the hirtus-group with molecular data. We aimed to (1) develop a molecular phylogeny for the group; (2) estimate the timing and pattern of diversification in the hirtus-group, and (3) gain insight into how these cave beetles diversified across distinct ecoregions and in the southern Cumberland Plateau.

Materials and methods

Specimens

Representatives of all 19 species of the hirtus-group were collected from 2012 to 2014. The Tennessee Wildlife Resources Agency permitted work in Tennessee (permit #1605). The Georgia Department of Natural Resources permitted work in Georgia (permit #8934). The National Park Service permitted collection of P. hirtus from Mammoth Cave National Park (permit #MACA-2013-SCI-0008). P. shapardi specimens from Oklahoma were collected by Matthew Niemiller. Two outgroup species representing the other main lineages in the subgenus Adelops (P. cavernicola and P. consobrinus) were collected in Florida. All beetles were collected by hand, typically with an aspirator or moist brush, and stored in 95% ethanol at -20°C. Seven species were collected from their type locality and several other species were collected from sites <1 km from their type locality. Sampling localities and species names are detailed in Table 1.

Table 1.

Ptomaphagus specimens, sampling locations and Genbank accession numbers.

Species Specimen Locality cox1 cytb rrnL-nad1
P. cavernicola Schwarz, 1898 KSZ13-127 USA: Warrens Cave, Alachua County, Florida KT167442 KT167490 KT167394
P. consobrinus (LeConte, 1853) KSZ13-128 USA: Tallahassee, Florida KT167443 KT167491 KT167395
P. barri Peck, 1973 TCN35_1 USA: Gunters Cave, Cannon County, Tennessee KT167444 KT167492 KT167396
TCN37_1 USA: Pleasant Ridge Cave, Cannon County, Tennessee KT167445 KT167493 KT167397
TCN37_2 USA: Pleasant Ridge Cave, Cannon County, Tennessee KT167446 KT167494 KT167398
TCN78_1 USA: Frog Hole Cave, Cannon County, Tennessee KT167447 KT167495 KT167399
P. chromolithus Peck, 1984 AJK601_1 USA: Dub Green Cave, Jackson County, Alabama KT167448 KT167496 KT167400
AJK601_2 USA: Dub Green Cave, Jackson County, Alabama KT167449 KT167497 KT167401
P. episcopus Peck, 1973 AMS3278_1 USA: Bloody Head Cave, Marshall County, Alabama KT167450 KT167498 KT167402
P. fecundus Barr, 1963 TFR2_2 USA: Caney Hollow Cave, Franklin County, Tennessee KT167451 KT167499 KT167403
P. fiskei Peck, 1973 GWK57_1 USA: Pigeon Cave, Walker County, Georgia KT167452 KT167500 KT167404
GWK57_2 USA: Pigeon Cave, Walker County, Georgia KT167453 KT167501 KT167405
P. hatchi Jeannel, 1933 AJK289_1 USA: Kyles Cave, Jackson County, Alabama KT167454 KT167502 KT167406
AJK289_2 USA: Kyles Cave, Jackson County, Alabama KT167455 KT167503 KT167407
AJK826_1 USA: Roadside Cave, Jackson County, Alabama KT167456 KT167504 KT167408
AJK826_2 USA: Roadside Cave, Jackson County, Alabama KT167457 KT167505 KT167409
TFR423_6 USA: Grapevine Cave, Franklin County, Tennessee KT167458 KT167506 KT167410
TFR423_7 USA: Grapevine Cave, Franklin County, Tennessee KT167459 KT167507 KT167411
TGD10_1 USA: Crystal Cave, Grundy County, Tennessee KT167460 KT167508 KT167412
TGD10_2 USA: Crystal Cave, Grundy County, Tennessee KT167461 KT167509 KT167413
P. hazelae Peck, 1973 AJK459_1 USA: Geiger Cave, Jackson County, Alabama KT167462 KT167510 KT167414
P. hirtus (Tellkampf, 1844) KWH_1 USA: White Cave, Edmonson County, Kentucky KT167463 KT167511 KT167415
KWH_2 USA: White Cave, Edmonson County, Kentucky KT167464 KT167512 KT167416
P. hubrichti Barr, 1958 TCN26_1 USA: Tenpenny Cave, Cannon County, Tennessee KT167465 KT167513 KT167417
TCN26_2 USA: Tenpenny Cave, Cannon County, Tennessee KT167466 KT167514 KT167418
TDK8_1 USA: Cripps Mill Cave, DeKalb County, Tennessee KT167467 KT167515 KT167419
TDK8_2 USA: Cripps Mill Cave, DeKalb County, Tennessee KT167468 KT167516 KT167420
P. julius Peck, 1973 AJK974_1 USA: House of Happiness Cave, Jackson County, Alabama KT167469 KT167517 KT167421
AJK974_2 USA: House of Happiness Cave, Jackson County, Alabama KT167470 KT167518 KT167422
P. laticornis Jeannel, 1949 AJK290_1 USA: Rousseau Entrance to Gary Self Pit, Jackson County, Alabama KT167471 KT167519 KT167423
AJK290_2 USA: Rousseau Entrance to Gary Self Pit, Jackson County, Alabama KT167472 KT167520 KT167424
P. loedingi (Hatch, 1933) AMD120_3 USA: Cold Spring Cave, Madison County, Alabama KT167473 KT167521 KT167425
AMD120_4 USA: Cold Spring Cave, Madison County, Alabama KT167474 KT167522 KT167426
AMD60_2 USA: Cave Spring Cave, Madison County, Alabama KT167475 KT167523 KT167427
AMD60_3 USA: Cave Spring Cave, Madison County, Alabama KT167476 KT167524 KT167428
P. longicornis Jeannel, 1949 AJK310_1 USA: Crossings Cave, Jackson County, Alabama KT167477 KT167525 KT167429
AJK310_2 USA: Crossings Cave, Jackson County, Alabama KT167478 KT167526 KT167430
AMD6_1 USA: Hering Cave, Madison County, Alabama KT167479 KT167527 KT167431
P. shapardi Sanderson, 1939 KSZ13-137 USA: Wady Cave #86, Adair County, Oklahoma KT167480 KT167528 KT167432
P. solanum Peck, 1973 AJK166_1 USA: Sheldon’s Cave, Jackson County, Alabama KT167481 KT167529 KT167433
P. torodei Peck, 1984 AJK1068_1 USA: Two Way Cave, Jackson County, Alabama KT167482 KT167530 KT167434
AJK1068_2 USA: Two Way Cave, Jackson County, Alabama KT167483 KT167531 KT167435
P. valentinei Jeannel, 1949 AJK174_1 USA: Schiffman Cave, Jackson County, Alabama KT167484 KT167532 KT167436
AJK174_2 USA: Schiffman Cave, Jackson County, Alabama KT167485 KT167533 KT167437
P. walteri Peck, 1973 ABA355_1 USA: Bryant Cave, Blount County, Alabama KT167486 KT167534 KT167438
ABA355_2 USA: Bryant Cave, Blount County, Alabama KT167487 KT167535 KT167439
P. whiteselli Barr, 1963 GDD66_1 USA: Byers Cave, Dade County, Georgia KT167488 KT167536 KT167440
GDD66_2 USA: Byers Cave, Dade County, Georgia KT167489 KT167537 KT167441

Molecular methods

We amplified and sequenced three regions of the mitochondrial genome (cox1, cytb, rrnL-trnL-nad1) totaling on average 2300 bp. These regions were previously used in studies of palearctic Leiodidae (Ribera et al. 2010, Fresneda et al. 2011, Rizzo et al. 2013, Cieslak et al. 2014). DNA extractions and PCR amplifications followed standard protocols (Dixon and Zigler 2011). The primers used were based on Ribera et al. (2010) but modified based on transcriptome sequence information available from Ptomaphagus hirtus (Friedrich et al. 2011) (Table 2). Both strands of successful PCRs were sequenced on an ABI3730. Sequences were aligned and edited in Sequencher (v. 4.9, GeneCodes Corp).

Table 2.

Primers used, in 5’ to 3’ orientation. Primers were based on Ribera et al. (2010) but modified based on sequences available from Ptomaphagus hirtus (Friedrich et al. 2011).

Gene Region Primer Orientation Sequence
cox1 hatchi.COIfor Forward CTGGTGGTGGGGATCCAATTC
hirtus.COIfor Forward CAGGAGGTGGAGATCCTATTC
hatchi.COIrev Reverse GCTTAAATTCATTGCACTAATCTGC
hatchi.COIrev2 Reverse TAAATTCATTGCACTAATCTGCCAT
cytB CB3 Forward GAGGAGCTACAGTTATTACAAA
CB4 Reverse AATAAAAAATATCATTCTGGTTGAAT
rrnL-trnL-nad1 16SaR Forward CGCCTGTTTAWCAAAAACAT
16SaNew Forward CTTAAGTCTAATCTGCCCAATG
16Sc Forward GATTGCGACCTCGATGTTGGA
nad1 Reverse ATTAGAATTTGAAGATCAACCTG
16Sb Reverse CCGATTTAAACTCAGATCATGT
nadnew Reverse ATTTCATAAGAAATAGTTTGAGC

We sequenced the three gene regions from 48 individuals from 29 populations, including all 19 species of the hirtus-group and two outgroups (P. cavernicola and P. consobrinus) representing the other Adelops species-groups (Peck 1973). In 19 cases, we sequenced two individuals from the same cave. For five species, we sequenced individuals from more than one cave. All sequences have been submitted to Genbank (KT167394-KT167537; Table 1).

Molecular tree estimation

The lack of indels or stop codons in the protein-coding cox1, cytb, and nad1 regions allowed for unambiguous multiple sequence alignment across all sites. The ribosomal and transfer RNA coding rrnL-trnL sequences were aligned using MAFFT (Katoh et al. 2005). Similar alignments were obtained using MUSCLE (Edgar 2004) and CLUSTAL (Larkin et al. 2007). Bayesian analysis was conducted with MrBayes v.3.2.2 (Ronquist and Huelsenbeck 2003), using four partitions (cox1, cytb, rrnL-trnL, nad1). Evolutionary models were estimated prior to the analysis with jModelTest v.2.1 (Posada 2008). GTR+I+Γ was the preferred model for all partitions except nad1 (TIM1+I+Γ) by AIC. MrBayes ran for 60 million generations using default values and the GTR+I+Γ model for each partition, saving every 6,000th tree. 10% of values were discarded as burnin. Similar results were obtained using codon-position partitions for the three protein coding regions and from a two partition approach (protein coding and non-protein coding sequences); both yielded similar or identical topologies with the only differences occurring at poorly-supported nodes.

Maximum likelihood searches were conducted using RAxML (Stamatakis 2014) with a GTR+Γ model used for each of the four partitions. Branch support was evaluated by rapid bootstrapping over 1,000 replicates (Suppl. material 3). Maximum likelihood analyses yielded similar topologies and node support to the Bayesian analyses.

Divergence time estimation

Divergence time estimates were generated with BEAST v1.8.1 (Drummond et al. 2012) using a total chain length of 60,000,000 generations with sampling every 1,000 generations. A Yule type speciation model with a wide normal distribution of tree height (treeModel.rootHeight = normal, initial: 15, Mean 15, Stdev 6, 95% of distribution between 5.495 mya and 24.89 mya) was used to model the tree. (We obtained similar results for tree height when using a uniform prior distribution of tree height between 5-25 mya.) The four data partitions shared a lognormal relaxed clock model with a substitution rate of 0.01 substitutions/site/my (stddev 0.002) (Rizzo et al. 2013). Each partition was assigned its own GTR+I+Γ substitution model. Tree topology was constrained to require monophyletic clades recovered with greater than 0.90 posterior probability in both MrBayes trees to appear in the final tree. We confirmed the convergence of parameter estimates by examination of three simultaneous runs using Tracer v1.5. Resulting tree files were summarized using TreeAnnotator v1.8.1, discarding 25% of samples as burnin and visualized using FigTree v1.4.2 (http://tree.bio.ed.ac.uk/software/figtree/).

Results

Phylogenetic relationships and molecular clock estimates of diversification in the hirtus-group based on mitochondrial DNA sequences

Adopting the approach of Ribera et al. (2010), we produced a molecular phylogeny for the hirtus-group based on sequences from five genes across three mitochondrial regions, applying the molecular clock developed for the same genes in this subfamily of beetles (Leiodidae: Cholevinae) to establish divergence times for the phylogeny. Using that approach, the hirtus-group is estimated to have diverged from the consobrinus- and cavernicola-groups around 15 mya (Fig. 3). Within the hirtus-group we observed three stages of diversification. First, we found strong support for the soil-dwelling and geographically separated P. shapardi as sister species to the 18 cave-obligate species of the hirtus-group, with the two lineages diverging ~10 mya (Fig. 3). This divides the sole member of the hirtus-group from the Ozarks from the rest of the species in the southeastern United States (Fig. 2A). In the second stage of diversification, seven geographically distinct lineages originated between 8.5 and 6 mya (Fig. 3) across Kentucky, Tennessee, Alabama and Georgia, spreading hirtus-group members across several ecoregions (Fig. 2A). We were unable to resolve the branching order of these lineages with high confidence (Fig. 3). Six of these lineages are currently represented by a single species - P. barri, P. fiskei, P. hirtus, P. hubrichti, P. walteri and P. whiteselli (Figs 2A, 3). The seventh lineage contains all the species from the southern Cumberland Plateau (Fig. 2B), which form a well-supported clade (Fig. 3). In the third stage of diversification, the South Cumberlands lineage expanded from one to 12 species beginning around 6 mya. The branching order in the South Cumberlands clade is well-resolved (Fig. 3).

Figure 3. 

Ultrametric tree for the hirtus-group. Bayesian tree estimated from combined partial mitochondrial sequence data. Branches supported by posterior probability >0.90 are labeled with values or, for branches with posterior probability of 1.0, an asterisk. Blue bars indicate 95% confidence intervals of estimated ages for the nodes. Taxa are labeled with species name and specimen identifier (Table 1). Scale at bottom indicates divergence times in millions of years as estimated by BEAST (Drummond et al. 2012). Branch colors correspond to those in Figure 2A.

Ptomaphagus hatchi is polyphyletic

Most specimens sampled for a single presumed species formed monophyletic groups in our molecular phylogeny. This was not the case, however, for the P. hatchi specimens sampled from four different sites. Our molecular phylogenetic analysis reveals that P. hatchi constitutes a polyphyletic clade with respect to six species (P. chromolithus, P. episcopus, P. fecundus, P. laticornis, P. torodei and P. valentinei) with which it has overlapping or adjacent distribution ranges on the southern Cumberland Plateau (Figs 2, 3). One well supported clade joins several populations of P. hatchi with P. episcopus, P. fecundus and P. chromolithus (Fig. 3). A second well supported clade joins P. hatchi with P. laticornis (Fig. 3). We further noted that the intraspecific (between cave) divergence between P. hatchi populations was high, ranging from 1.2 to 5.1% P-distance for the cox1 gene (Suppl. material 2). Intraspecific (between cave) distances for populations of other Ptomaphagus species are all < 2.0% (Suppl. material 2). In several cases, the intraspecific P. hatchi divergence is greater than the interspecific divergence observed between other Ptomaphagus species.

Intraspecific molecular variation

To assess genetic diversification within and between lineages, we also surveyed intraspecific variation at population (within cave) and species (between cave) levels. In 19 cases (representing 14 species), we sequenced two individuals from the same cave. Variation between individuals from the same cave was low, with a mean cox1 p-distance of 0.15% (N = 19, range = 0.00 - 0.58%) (Suppl. material 1). In all 19 cases individuals from the same cave were each other’s closest relatives (Fig. 3).

For five species, we sampled animals from multiple caves. Specifically, we sampled P. hubrichti, P. loedingi and P. longicornis from two caves, P. barri from three caves, and P. hatchi from four caves. Intraspecific variation between caves had a mean cox1 p-distance of 2.1% for all pairwise comparisons (N = 12, range = 0.2 - 5.1%) (Suppl. material 2). Intraspecific variation between caves across the 2300 bp of all five sampled loci was slightly lower (mean p-distance = 1.7%), consistent with the previous observation that the cox1 region evolves faster than the other mitochondrial regions in this group (Ribera et al. 2010) (Suppl. material 2).

Discussion

The hirtus-group diversified in three stages

Our molecular phylogeny provides a time-calibrated picture of the diversification of the hirtus-group, shedding new light on the origins of an important component of cave biodiversity in North America. The integration of molecular and biogeographic data now suggests that the hirtus-group diversified in three stages. The first stage, occurring mid-Miocene ~10 mya, separated the sole extant eutroglophile in the hirtus-group, P. shapardi, located in the central United States from the 18 exclusively troglobiotic species located in the southeastern United States (Figs 2A, 3). The second stage of diversification spawned seven lineages across the southeastern United States during the late Miocene, 8.5-6 mya (Figs 2A, 3). In the third stage, further fine scale diversification occurred in the southern Cumberland Plateau region during the Pliocene and Pleistocene over the past six million years (Figs 2B, 3).

How many times have Ptomaphagus invaded cave habitats

During the second stage of hirtus-group diversification, the lineages that diversified into the 18 cave-obligate members of the hirtus-group were established in five distinct geographic regions (Fig. 2A): the Mammoth Cave region of Kentucky, central Tennessee, northwest Georgia, the southern end of the Sequatchie Valley in Alabama, and the southern Cumberland Plateau in Tennessee and Alabama. Although further investigation of the deeper nodes of the hirtus-group phylogeny is still warranted, it appears that the two species in central Tennessee (P. barri and P. hubrichti) do not form a monophyletic group, nor do the two species in northwest Georgia (P. fiskei and P. whiteselli). This suggests that distinct hirtus-group lineages invaded underground habitats as many as seven times. Any alternative explanation requires one or more episodes of up to 75 km long-distance dispersal across significant non-karst terrain separating current species distributions. We do not favor long-distance dispersal as an explanation for current species distributions as the dispersal ability of hirtus-group members appears to be quite limited. All species are wingless and small, and none have been collected in surface habitats. Even short-distance migrations appear unlikely, as two species have never been collected in the same cave, which is particularly notable in the case of the cave- and species-rich southern Cumberland Plateau. In many cases, uninhabited cave habitats are present within just one or a few kilometers of known hirtus-group populations (Peck 1973), indicating extremely low vagility across the hirtus-group.

Further consistent with minimal dispersal ability is the fact that the southern Cumberland Plateau lineage diversified into twelve species over the past 6 million years and no members of this lineage appear to have migrated from the southern Cumberland Plateau. Notwithstanding the strong circumstantial evidence, long-distance migration cannot be completely discounted as an explanation for some aspects of the species distributions we see today. For instance, long-distance dispersal has been proposed for one group of troglobiotic leiodids in the palearctic realm (Troglocharinus of Spain; Rizzo et al. 2013). Rizzo et al. (2013) proposed these beetles expanded their range in the early Pliocene from the central Pyrenees across a significant non-karst region to coastal karst habitats 60–70 km away, via stepping-stone migration across the surface during a permissive climate period, followed by subsequent isolation of the two lineages (Rizzo et al. 2013).

The limited dispersal capacity of troglomorphic (microphthalmic and wingless) Ptomaphagus species suggests that troglomorphy developed multiple times through convergent evolution in this group. This scenario and its implications could be further scrutinized at the molecular level. Previous transcriptome analyses on P. hirtus, for example, identified several genes in the ommochrome eye pigmentation pathway that are no longer expressed in P. hirtus, consistent with the lack of pigment granules in the highly reduced eyelets of this species (Friedrich et al. 2011). Similarly reduced and non-pigmented eyelets are found in all other cave-adapted species of the hirtus-group. A single cave colonization event during early hirtus-group evolution would predict shared lack-of-function mutations underlying the regression of eyes and eye pigmentation across the hirtus-group. Multiple independent cave colonization events, in contrast, would be reflected by a lack of shared lack-of-function mutations in eye pigmentation genes. This approach, which can be extended to other cave adaptive traits, will ultimately require genomic analyses to determine whether identical mutations are present in geographically distinct populations (consistent with a single cave invasion and the evolution of troglomorphy followed by long-distance dispersal) or whether different mutations are present in different lineages (consistent with multiple cave invasions followed by the convergent evolution of troglomorphy). Consistent with independent cave invasions and evidence for the feasibility of such an approach, distinct mutations have been observed in the pigmentation gene cinnabar and in the opsin genes of subterranean diving beetles (Leys et al. 2005, Tierney et al. 2015) and in rhodopsin genes of cavefish (Niemiller et al. 2013) in geographically distinct populations of those groups.

A new model of hirtus-group diversification: Vicariance by erosion

The Climatic Relict Hypothesis suggests that a species’ initial colonization of caves occurred when it sought refuge from environmental stressors in the surface environment (reviewed in Culver and Pipan 2009). The Climatic Relict Hypothesis is often proposed for troglobiotic taxa lacking close relatives on the surface, with those relatives presumably extinct as a result of the changing surface conditions that forced the proto-troglobiotic taxa underground. The Climatic Relict Hypothesis can be supported by evidence that the cave species originated or diversified during a period of climate change. A convincing case for the Climatic Relict Hypothesis was developed by Leys et al. (2003) for Australian diving beetles where numerous independent invasions of isolated calcrete aquifers occurred. Leys et al. (2003) used a molecular clock to show that the timing of these invasions correlated with increasing aridity moving across the region from north to south during the Pliocene. In North America, the Climatic Relict Hypothesis has often been suggested as a driver of cave colonization related to climate change during late Pleistocene glaciation events (Culver and Pipan 2009). Peck (1973, 1984) offered the hirtus-group as a possible example of cave colonization via the Climatic Relict Hypothesis. To explain the species diversity of the hirtus-group, Peck (1973, 1984) suggested that the first Ptomaphagus to invade cave habitats subsequently dispersed to nearby caves during recent Pleistocene interglacial periods via cool and moist habitats such as leaf litter, talus or moss mats, after which the species became more completely cave adapted and isolated.

Our time-calibrated molecular phylogeny rejects the hypothesis of middle to late Pleistocene diversification in the hirtus-group. We found the timing of most speciation events in the hirtus-group to be an order of magnitude greater than Peck hypothesized (Peck 1973, 1984). Our divergence time estimates are similar to those derived from molecular data in other troglobiotic groups (e.g., Leys et al. 2003, Faille et al. 2010, Ribera et al. 2010, Derkarabetian et al. 2010, Niemiller et al. 2012). The divergence times estimated by these studies indicate that the species in these groups are much older than the recent Pleistocene. With most diversification of the hirtus-group occurring in the Miocene and Pliocene, we can rule out the Climatic Relict Hypothesis related to Pleistocene glaciations as a general rule for the hirtus-group.

Now recognizing that the third stage of hirtus-group diversification, the radiation in the southern Cumberland Plateau, began ~6 mya, we hypothesize that cave-adapted Ptomaphagus populations distributed throughout the region were isolated by vicariant events as the southern Cumberland Plateau eroded and fragmented over millions of years. Barr and Holsinger (1985) suggest gene flow between cave systems can be reduced via “simple erosion that divides a karst area into isolated segments by cutting down into underlying noncavernous strata.” This mechanism is particularly applicable to terrestrial troglobionts, whose populations are unlikely to maintain connectivity via deep groundwater connections, as might be the case in aquatic troglobionts (e.g., Fenolio et al. 2017). The southern Cumberland Plateau is greatly dissected, with numerous isolated and peripheral mountains and ridges, and hirtus-group species are frequently limited to a single isolated ridge. For example, P. longicornis is limited to caves on Keel Mountain (in Madison and Jackson Counties, Alabama), P. julius is limited to caves on July Mountain (Jackson County, Alabama), and P. solanum is limited to Tater Knob (Jackson County, Alabama). Each of these ridges is an isolated remnant of the Cumberland Plateau (Fig. 4). Further consistent with the vicariance by erosion model (Fig. 5), the earliest lineages to diverge in the South Cumberlands clade (P. julius, P. hazelae + P. solanum, P. loedingi and P. longicornis) are found in peripheral and isolated ridges at the edge of the southern Cumberland Plateau, whereas later-diverging lineages are concentrated in the more intact central region of the southern Cumberland Plateau (Figs 3, 4).

Figure 4. 

Distribution of Ptomaphagus species on the southern Cumberland Plateau, overlaid on a digital elevation model. Higher elevations (to 500 m) are indicated by darker shades, lower elevations (to 180 m) by lighter shades. Ptomaphagus species diverging early in the South Cumberlands lineage are limited to isolated ridges and mountains on the fringes of the plateau. These species are P. loedingi (yellow), P. longicornis (dark gray), P. julius (blue), P. solanum (dark green) and P. hazelae (light blue). The colors used here correspond to those in Figure 2B.

Figure 5. 

Biogeographic and phylogenetic expectations for a ‘vicariance by erosion’ scenario as hypothesized for the southern Cumberland Plateau. A–C Karst (gray) erodes and fragments over time, leading to the isolation and divergence of cave populations (colored circles) in the remaining patches of karst D A phylogeny consistent with the vicariance by erosion process, with taxa that diverge early distributed at the periphery of the eroding region.

Although we lack a clear picture of the timing and pattern of erosion and fragmentation of the southern Cumberland Plateau, it is clear that the ~6 my over which the South Cumberlands lineage diversified is sufficient for significant erosion and cave development to have occurred. In support of this, on the western edge of the Cumberland Plateau in middle Tennessee, extensive stream incision, erosion and cave development occurred over a similar period of time. In this region, the oldest caves (now located 60–90 m above current river level) were estimated to be 3.5–5.7 my old based on the dating of radioactive cave sediments (Sasowsky et al. 1995, Anthony and Granger 2004, 2007). Assuming a similar degree of erosion in the southern Cumberland Plateau, it is reasonable to assume that the hirtus-group has been heavily impacted by fragmentation, resulting in cave population isolation events over the past 6 my.

Questions arising from the present study

Understanding the lack of hirtus-group species diversity in the Mammoth Cave region

The hirtus-group is widespread in the Mammoth Cave region of Kentucky and in the southern Cumberland Plateau of Tennessee and Alabama (Fig. 2). Measured as extent of occupancy (Bachman et al. 2011), the range extent of hirtus-group species in the two regions is similar: 3,952 km2 in the Mammoth Cave region and 4,151 km2 in the southern Cumberland Plateau. It is striking that, across these similar ranges, only one species (P. hirtus) is present in the Mammoth Cave region, whereas 12 species are present in the southern Cumberland Plateau. As discussed above, the diversification in the southern Cumberland Plateau may be related to more frequent occurrence of vicariance by erosion, in contrast to the more continuous karst of the Interior Plateaus in the Mammoth Cave region. Indeed, such patterns have been proposed in the past (e.g., Barr and Holsinger 1985 and references therein).

One prediction from this scenario is that P. hirtus evolved less genetic diversity across its range than we observed across the South Cumberlands lineage. Alternatively, P. hirtus may represent a collection of cryptic species, as has been observed in numerous cave lineages (e.g., Trontelj et al. 2009, Derkarabetian et al. 2010, García-Machado et al. 2011, Hedin 2015, Zhang and Li 2013). Our analysis presented here sampled only a single P. hirtuspopulation (Table 1). Thus, further phylogeographic and population genetic studies of P. hirtus are warranted to clarify whether current species definitions are consistent with the genetic diversity present in the region. Such studies are further recommended given the evidence of cryptic species in what has previously been considered a single taxon, P. hatchi.

Molecular evidence that Ptomaphagus hatchi is polyphyletic

With the exception of P. hirtus, P. hatchi has the largest range extent of any hirtus-group species. P. hatchi is also the only member of the hirtus-group with a range that overlaps those of other species in the group. We found that the current species definition of P. hatchi is polyphyletic with respect to six species (P. chromolithus, P. episcopus, P. fecundus, P. laticornis, P. torodei and P. valentinei) from the southern Cumberland Plateau lineage (Figs 2, 3). Peck’s (1983, 1984) study of species boundaries within P. hatchi relied on distinctions in the female spermatheca (Peck 1984) and evidence of reproductive isolation in various interpopulational crosses (Peck 1983). In the most recent taxonomic revision, Peck (1984) restricted P. hatchi to populations with ‘form I’ spermathecae and described P. laticornis (with ‘form II’ spermathecae) and P. chromolithus (with ‘form III’ spermathecae). He also described P. torodei as a close relative of P. valentinei and raised P. fecundus to full species status (Peck 1984).

Significantly, our mitochondrial sequence divergence data do not align with these distinctions. This could be due to a more dynamic variability of spermatheca form than previously envisioned. Alternatively, ‘form I’ spermathecae may represent an ancestral state that has been retained in some but not all descendant lineages (now called P. hatchi), leading to the erroneous support for a polyphyletic taxon based on the shared similarity of a plesiomorphic character state, i.e. symplesiomorphy. It is also possible that hybridization and introgression have confused the molecular phylogenetic picture of these lineages as we only analysed mitochondrial DNA. This, however, seems unlikely as two species of Ptomaphagus (or two spermathecal forms) have never been reported from the same cave (Peck 1984). At present, the available molecular data are too limited to recommend taxonomic revision, but further molecular analysis of these taxa across their distributions has now become essential to gain a reliable understanding of the hirtus-group diversification.

“Vicariance by erosion” and the development of a cave biodiversity hotspot on the southern Cumberland Plateau

Exhibiting high levels of taxonomic diversity and endemism, the southern Cumberland Plateau is a hotspot for cave biodiversity. This region has been compared to other centers of cave biodiversity such as the Dinaric karst of Slovenia, the French Pyrenees and the Mammoth Cave region (Culver et al. 2006). This biodiversity peaks in a six-county region in northeast Alabama and south-central Tennessee. Totaling ~10,000 sq km, this region has more than 4400 known caves that support more than 150 troglobionts (Culver et al. 2000, Niemiller and Zigler 2013). Members of the hirtus-group compose nearly 10% of the troglobionts present in the southern Cumberland Plateau.

With a few exceptions, we lack time-calibrated molecular phylogenies for troglobionts from the southern Cumberland Plateau. This has limited our understanding of the development of biodiversity in this cave biodiversity hotspot. Important exceptions exist for several aquatic taxa including crustaceans, fish and salamanders (Buhay and Crandall 2005, and comment in Trontelj 2007, Niemiller et al. 2008, Niemiller et al. 2012). These studies indicate diversification during the Pleistocene for all of these taxonomically diverse groups. Here, we provide the first time-calibrated study of a diverse terrestrial troglobiont group from the region. We found that the diversification of the South Cumberlands lineage of the hirtus-group extended across ~6 my, beginning near the end of the Miocene and continuing through the Pliocene and Pleistocene (Fig. 3). Thus, it appears troglobionts have accumulated in the southern Cumberland Plateau since at least the late Miocene.

We therefore suggest that vicariance by erosion played a generally significant role in the accumulation of troglobiotic species in this biodiversity hotspot. Better models of the fragmentation of the southern Cumberland Plateau and the development of time-calibrated phylogenies for other species-rich terrestrial troglobiotic taxa from the region (such as pseudoscorpions and millipedes) would allow further evaluation of “vicariance by erosion” model (Fig. 5) for the southern Cumberland Plateau cave biodiversity hotspot.

Acknowledgments

We thank Kurt Helf, Matthew Niemiller, Stewart Peck, Rick Toomey and Maja Zagmajster for assistance with collections, Stewart Peck for assistance with photographic documentation of collected specimens, and two reviewers for helpful comments. This project was supported by the University of the South and the Shearwater Foundation.

References

  • Anthony DM, Granger DE (2004) A late Tertiary origin for multilevel caves along the western escarpment of the Cumberland Plateau, Tennessee and Kentucky, established by cosmogenic 26Al and 10Be. Journal of Cave and Karst Studies 66(2): 46–55. https://doi.org/10.1002/esp.1446
  • Anthony DM, Granger DE (2007) A new chronology for the age of Appalachian erosional surfaces determined by cosmogenic nuclides in cave sediments. Earth Surface Processes and Landforms 32(6): 874–887.
  • Bachman S, Moat J, Hill AW, de Torre J, Scott B (2011) Supporting Red List threat assessments with GeoCAT: geospatial conservation assessment tool. ZooKeys 150: 117–126. https://doi.org/10.3897/zookeys.150.2109
  • Cieslak A, Fresneda J, Ribera I (2014) Life-history specialization was not an evolutionary dead-end in Pyrenean cave beetles. Proceedings of the Royal Society B. 281: 20132978. https://doi.org/10.1098/rspb.2013.2978
  • Culver DC, Pipan T (2009) The biology of caves and other subterranean habitats. Oxford University Press, Oxford, 254 pp.
  • Derkarabetian S, Steinmann DB, Hedin M (2010) Repeated and time-correlated morphological convergence in cave-dwelling harvestmen (Opiliones, Laniatores) from montane western North America. PLoS One 5: e10388. https://doi.org/10.1371/journal.pone.0010388
  • Dixon GB, Zigler KS (2011) Cave-obligate biodiversity on the campus of Sewanee: The University of the South, Franklin County, Tennessee. Southeastern Naturalist 10: 251–66. https://doi.org/10.1656/058.010.0206
  • Drummond AJ, Suchard MA, Xie D, Rambaut A (2012) Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29: 1969–1973. https://doi.org/10.1093/molbev/mss075
  • Faille A, Ribera I, Deharveng L, Bourdeau C, Garnery L, Quéinnec E, Deuve T (2010) A molecular phylogeny shows the single origin of the Pyrenean subterranean Trechini ground beetles (Coleoptera: Carabidae). Molecular Phylogenetics and Evolution 54: 97–106. https://doi.org/10.1016/j.ympev.2009.10.008
  • Fenolio DB, Niemiller ML, Gluesenkamp AG, McKee AM, Taylor SJ (2017) New Distributional Records of the Stygobitic Crayfish Cambarus cryptodytes (Decapoda: Cambaridae) in the Floridan Aquifer System of Southwestern Georgia. Southeastern Naturalist 16: 163–181. https://doi.org/10.1656/058.016.0205
  • Fresneda J, Grebennikov VV, Ribera I (2011) The phylogenetic and geographic limits of Leptodirini (Insecta: Coleoptera: Leiodidae: Cholevinae), with a description of Sciaphyes shestakovi sp. n. from the Russian Far East. Arthropod Systematics and Phylogeny 69: 99–123.
  • Friedrich M, Chen R, Daines B, Bao R, Caravas J, Rai PK, Zagmajster M, Peck SB (2011) Phototransduction and clock gene expression in the troglobiont beetle Ptomaphagus hirtus of Mammoth cave. Journal of Experimental Biology 214: 3532–3541. https://doi.org/10.1242/jeb.060368
  • García-Machado E, Hernández D, García-Debrás A, Chevalier-Monteagudo P, Metcalfe C, Bernatchez L, Casane D (2011) Molecular phylogeny and phylogeography of the Cuban cave-fishes of the genus Lucifuga: evidence for cryptic allopatric diversity. Molecular Phylogenetics and Evolution 61: 470–483. https://doi.org/10.1016/j.ympev.2011.06.015
  • Harvey MS (2002) Short-range endemism amongst the Australian fauna: some examples from non-marine environments. Invertebrate Systematics 16: 555–570. https://doi.org/10.1071/IS02009
  • Hedin M (2015) High‐stakes species delimitation in eyeless cave spiders (Cicurina, Dictynidae, Araneae) from central Texas. Molecular Ecology 24: 346–361. https://doi.org/10.1111/mec.13036
  • Katoh K, Kuma KI, Toh H, Miyata T (2005) MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Research 33: 511–8. https://doi.org/10.1093/nar/gki198
  • Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948. https://doi.org/10.1093/bioinformatics/btm404
  • Leys R, Watts CH, Cooper SJ, Humphreys WF (2003) Evolution of subterranean diving beetles (Coleoptera: DytiscidaeHydroporini, Bidessini) in the arid zone of Australia. Evolution 57: 2819–2834.
  • Leys R, Cooper SJ, Strecker U, Wilkens H (2005) Regressive evolution of an eye pigment gene in independently evolved eyeless subterranean diving beetles. Biology letters 1: 496–499. https://doi.org/10.1098/rsbl.2005.0358
  • Niemiller ML, Zigler KS (2013) Patterns of cave biodiversity and endemism in the Appalachians and Interior Plateau of Tennessee USA. PLoS ONE 8: e64177. https://doi.org/10.1371/journal. pone.0064177
  • Niemiller ML, Fitzpatrick BM, Miller BT (2008) Recent divergence with gene flow in Tennessee Cave Salamanders (Plethodontidae: Gyrinophilus) inferred from gene genealogies. Molecular Ecology 17: 2258–2275. https://doi.org/10.1111/j.1365-294X.2008.03750.x
  • Niemiller ML, Near TJ, Fitzpatrick BM (2012) Delimiting species using multilocus data: diagnosing cryptic diversity in the Southern Cavefish Typhlichthys subterraneus (Teleostei: Amblyopsidae). Evolution 66: 846–866. https://doi.org/10.1111/j.1558-5646.2011.01480.x
  • Niemiller ML, Fitzpatrick BM, Shah P, Schmitz L, Near TJ (2013) Evidence for repeated loss of selective constraint in rhodopsin of amblyopsid cavefishes (Teleostei: Amblyopsidae). Evolution 67: 732–748. https://doi.org/10.1111/j.1558-5646.2012.01822.x
  • Niemiller ML, Zigler KS, Ober KA, Carter ET, Engel AS, Moni G, Philips TK, Stephen CD (2017) Rediscovery and conservation status of six short‐range endemic Pseudanophthalmus cave beetles (Carabidae: Trechini). Insect Conservation and Diversity 10: 495–501. https://doi.org/10.1111/icad.12263
  • Njunjić I, Perrard A, Hendriks K, Schilthuizen M, Perreau M, Merckx V, Baylac M, Deharveng L (2018) Comprehensive evolutionary analysis of the Anthroherpon radiation (Coleoptera, Leiodidae, Leptodirini). PloS One 13:e0198367. https://doi.org/10.1371/journal.pone.0198367
  • Peck SB (1973) Systematic revision and the evolutionary biology of the Ptomaphagus (Adelops) beetles of North America (Coleoptera; Leiodidae: Catopinae), with emphasis on cave-inhabiting species. Bulletin of the Museum of Comparative Zoology 145: 29–162.
  • Peck SB (1984) The distribution and evolution of cavernicolous Ptomaphagus beetles in the southeastern United States (Coleoptera; Leiodidae; Cholevinae) with new species and records. Canadian Journal of Zoology 62: 730–40. https://doi.org/10.1139/z84-103
  • Peck SB, Newton AF (2017) An annotated catalog of the Leiodidae (Coleoptera) of the Nearctic region (continental North America north of Mexico). The Coleopterists Bulletin.71: 211–258. https://doi.org/10.1649/0010-065X-71.2.211
  • Peck SB, Wynne JJ (2013) Ptomaphagus parashant Peck & Wynne, new species (Coleoptera: Leiodidae: Cholevinae: Ptomaphagini): the most troglomorphic cholevine beetle known from western North America. The Coleopterists Bulletin 67: 309–317. https://doi.org/10.1649/0010-065X-67.3.309
  • Ribera I, Fresneda J, Bucur R, Izquierdo A, Vogler AP, Salgado JM, Cieslak A (2010) Ancient origin of a Western Mediterranean radiation of subterranean beetles. BMC Evolutionary Biology 10: 29. https://doi.org/10.1186/1471-2148-10-29
  • Rizzo V, Comas J, Fadrique F, Fresneda J, Ribera I (2013) Early Pliocene range expansion of a clade of subterranean Pyrenean beetles. Journal of Biogeography 40: 1861–1873. https://doi.org/10.1111/jbi.12139
  • Tierney SM, Cooper SJ, Saint KM, Bertozzi T, Hyde J, Humphreys WF, Austin AD (2015) Opsin transcripts of predatory diving beetles: a comparison of surface and subterranean photic niches. Royal Society Open Science 2: 140386. https://doi.org/10.1098/rsos.140386
  • Trontelj P (2007) The age of subterranean crayfish species. A comment on Buhay & Crandall(2005): Subterranean phylogeography of freshwater crayfishes shows extensive gene flow and surprisingly large population sizes. Molecular Ecology 16: 2841–2843. https://doi.org/10.1111/j.1365-294X.2007.03345.x
  • Trontelj P, Douady CJ, Fišer C, Gibert J, Gorički Š, Lefébure T, Sket B, Zakšek V (2009) A molecular test for cryptic diversity in ground water: how large are the ranges of macro‐stygobionts? Freshwater Biology 54: 727–744. https://doi.org/10.1111/j.1365-2427.2007.01877.x

Supplementary materials

Supplementary material 1 

Table S1. Mean cox1 P-distances between specimens from the same cave

Vincent L. Leray, Jason Caravas, Markus Friedrich, Kirk S. Zigler

Data type: statistical data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (46.00 kb)
Supplementary material 2 

Table S2. Mean cox1 and five gene (cox1, cytb, rrnL-trnL-nad1) P-distances between conspecific individuals from different caves

Vincent L. Leray, Jason Caravas, Markus Friedrich, Kirk S. Zigler

Data type: statistical data

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (43.50 kb)
Supplementary material 3 

Figure S1. Maximum likelihood majority rule consensus bootstrap tree

Vincent L. Leray, Jason Caravas, Markus Friedrich, Kirk S. Zigler

Data type: phylogenetic data

Explanation note: Maximum likelihood tree estimated from combined partial mitochondrial sequence data. Bootstrap values (from 1000 replicates) are indicated above branches. Taxa are labeled with species name and specimen identifier (Table 1).

This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited.
Download file (926.37 kb)
login to comment