Research Article |
|
Corresponding author: Francesco Ballarin ( ballarin.francesco@gmail.com ) Academic editor: Martina Pavlek
© 2020 Yuya Suzuki, Francesco Ballarin.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Suzuki Y, Ballarin F (2020) Nesticus kosodensis Yaginuma, 1972 bona species. Molecular and morphological separation from N. latiscapus Yaginuma, 1972 with notes on cave scaffold-web spiders subspecies in Japan (Araneae, Nesticidae). Subterranean Biology 35: 79-96. https://doi.org/10.3897/subtbiol.35.53933
|
The troglophilic spider subspecies Nesticus latiscapus kosodensis Yaginuma, 1972 is compared with its nominal species N. latiscapus Yaginuma, 1972 using an integrated taxonomic approach. Both morphological and molecular analysis suggest the two taxa are distinct, rejecting the status of subspecies. In the light of these results, N. kosodensis stat. nov. is elevated to species level and both species are redescribed. We expect that future revisions of Japanese Nesticidae will find that many currently designated subspecies are in fact distinct species. Taxonomic revision of long-established and unrevised subspecies may help to improve the conservation efforts aiming to protect the Japanese endemic cave fauna.
Asia, troglophilic spiders, species elevation, stat. nov., subterranean environment
Defining the boundaries among species is a key factor in modern systematics (
Nesticidae Simon,1894 is a family of spiders (16 genera and 278 species,
During field trips in central Japan (Yamanashi and Tokyo Prefectures), we collected several fresh specimens of the subspecies Nesticus latiscapus kosodensis Yaginuma, 1972 and its nominal species N. latiscapus Yaginuma, 1972. These spiders are found in caves and similar environments within a relatively restricted area in central Japan. Due to their presumed morphological similarities and close geographic distributions, N. latiscapus kosodensis has long been considered a variant of N. latiscapus. The aim of this study is to compare the morphology and genetic distances of these two taxonomic units, and test the concept of subspecies among Japanese cave spiders.
Collecting sites were centred in Yamanashi and Tokyo Prefectures, central Japan. Spider samples were predominantly collected from caves, but some were found under rocks. Specimens were preserved in 95% ethanol for molecular and morphological analysis. Specimen morphology was examined using a Nikon SMZ1270 stereomicroscope (for N. latiscapus) or a Nikon AZ100M stereomicroscope (for N. kosodensis stat. nov.), and photographed with a Canon EOS Kiss x8i digital camera attachment. Photos were combined using the image stacking software Helicon Focus 6.7.1. and further processed with Adobe Photoshop CC 2015. Epigynes were dissected using a sharp scalpel, and cleared by boiling them in a 20% KOH solution for several minutes until clear. Leg measurements are reported in the text as total length (femur, patella, tibia, metatarsus, tarsus). All measurements are in millimeters. The following abbreviations are used in text or figures: Be = bulge of embolus; Co = copulatory opening; Dp1-3 = dorsal processes of paracymbium; Di = distal process of paracymbium; E = embolus; Id + Fd = insemination and fertilization ducts; Ma = median apophysis; P = paracymbium; Pc1-3 = processes of conductor complex; S = spermatheca; Sc = scapus; St = subtegulum; T = tegulum; Ta = tegular apophysis; Vp = vulval pocket; Vpp = ventral process of paracymbium. Specimens used in this study are stored in the following collections: FBPC = F. Ballarin personal collection; YSPC = Y. Suzuki personal collection; NSMT = National Museum of Nature and Science, Tokyo, Japan; TSPC: T. Suguro personal collection.
Fresh specimens were identified at species level and subsequently stored at -20° at the Systematic Zoology Laboratory, Department of Biological Sciences, Tokyo Metropolitan University, Japan (TMU). DNA extraction and Polymerase Chain Reaction amplification (PCR) of the samples were performed in the same institute. Total genomic DNA was extracted using a Qiagen DNeasy Blood & Tissue Kit following the standard protocol suggested by the manufacturer. A fragment of the mitochondrial gene Cytochrome c oxidase subunit I (COI) was selectively amplified using the primers LCO1490 (forward) GGTCAACAAATCATCATAAAGATATTGG (
In order to evaluate the genetic distance between the taxa discussed in this study and other close related congeners from the same geographical area, a total of 13 Nesticus specimens belonging to four species were included in the analysis: N. kosodensis stat. nov. (4 specimens), N. latiscapus (7 specimens), N. shinkaii Yaginuma, 1979 and N. gondai Yaginuma, 1979 (1 specimen each). The latter two species were preferentially selected on the base of their geographic distribution and results of our preliminary studies on the phylogeny of the genus Nesticus. The phylogenetic tree was rooted using the species Cyclocarcina floronoides tatoro (
Maximum likelihood analysis (Fig.
Uncorrected genetic p-distance between Nesticus latiscapus, N. kosodensis stat. nov., and the other outgroup species based on the COI partial sequence discussed in the text.
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | ||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | Cy185 Nesticus latiscapus | |||||||||||||
| 2 | Cy184 Nesticus latiscapus | 0.002 | ||||||||||||
| 3 | Cy401 Nesticus latiscapus | 0.000 | 0.002 | |||||||||||
| 4 | Cy405 Nesticus latiscapus | 0.000 | 0.002 | 0.000 | ||||||||||
| 5 | Cy408 Nesticus latiscapus | 0.002 | 0.000 | 0.002 | 0.002 | |||||||||
| 6 | Cy077 Nesticus latiscapus | 0.002 | 0.000 | 0.002 | 0.002 | 0.000 | ||||||||
| 7 | Cy044 Nesticus latiscapus | 0.000 | 0.002 | 0.000 | 0.000 | 0.002 | 0.002 | |||||||
| 8 | Cy190 Nesticus kosodensis | 0.103 | 0.102 | 0.103 | 0.103 | 0.102 | 0.102 | 0.103 | ||||||
| 9 | Cy041 Nesticus kosodensis | 0.106 | 0.105 | 0.106 | 0.106 | 0.105 | 0.105 | 0.106 | 0.027 | |||||
| 10 | Cy042 Nesticus kosodensis | 0.106 | 0.105 | 0.106 | 0.106 | 0.105 | 0.105 | 0.106 | 0.027 | 0.000 | ||||
| 11 | Cy406 Nesticus kosodensis | 0.102 | 0.100 | 0.102 | 0.102 | 0.100 | 0.100 | 0.102 | 0.002 | 0.026 | 0.026 | |||
| 12 | Cy191 Nesticus gondai | 0.092 | 0.091 | 0.092 | 0.092 | 0.091 | 0.091 | 0.092 | 0.097 | 0.095 | 0.095 | 0.095 | ||
| 13 | Cy189 Nesticus shinkaii | 0.095 | 0.094 | 0.095 | 0.095 | 0.094 | 0.094 | 0.095 | 0.106 | 0.103 | 0.103 | 0.105 | 0.068 | |
| 14 | Cy183 Cyclocarcina floronoides tatoro | 0.085 | 0.083 | 0.085 | 0.085 | 0.083 | 0.083 | 0.085 | 0.100 | 0.100 | 0.100 | 0.098 | 0.041 | 0.073 |
Localities and related GenBank accession numbers of the specimens used in the molecular analysis. New sequences are indicated by an asterisk.
| Code | Species | COI | Locality |
|---|---|---|---|
| Cy184 | Nesticus latiscapus | MT524181* | Japan, Yamanashi Prefecture, Minamitsuru-gun, Fujikawaguchiko-machi, Saiko Bat Cave (西湖蝙蝠穴) |
| Cy185 | Nesticus latiscapus | MT524180* | Japan, Yamanashi Prefecture, Minamitsuru-gun, Fujikawaguchiko-machi, Ryugu Doketsu Cave (龍宮洞穴) |
| Cy401 | Nesticus latiscapus | MT524182* | Japan, Yamanashi Prefecture, Minamitsuru-gun, Fujikawaguchiko-machi, Narusawa Ice Cave (鳴沢氷穴) |
| Cy405 | Nesticus latiscapus | MT524183* | Japan, Yamanashi Prefecture, Minamitsuru-gun, Fujikawaguchiko-machi, Fugaku Wind Cave (富岳風穴) |
| Cy408 | Nesticus latiscapus | MT524184* | Japan, Yamanashi Prefecture, Minamitsuru-gun, Fujikawaguchiko-machi, surroundings of Saiko Bat Cave (西湖蝙蝠穴) |
| Cy077 | Nesticus latiscapus | MT524185* | Japan, Yamanashi Prefecture, Minamitsuru-gun, Fujikawaguchiko-machi, Narusawa area |
| Cy044 | Nesticus latiscapus | MT524186* | Japan, Yamanashi Prefecture, Minamitsuru-gun, Narusawa-mura, unnamed lava tunnel |
| Cy190 | Nesticus kosodensis | MT524187* | Japan, Tokyo Prefecture, Nishitama-gun, Okutama-machi, Nippara, Nippara Cave (日原鍾乳洞) |
| Cy406 | Nesticus kosodensis | MT524190* | Japan, Tokyo Prefecture, NishitamA-gun, Okutama, Nippara, surroundings of Nippara Cave (日原鍾乳洞) |
| Cy041 | Nesticus kosodensis | MT524188* | Japan, Yamanashi Prefecture, Kitatsuru-gun, Kosuge-mura, under stones |
| Cy042 | Nesticus kosodensis | MT524189* | Japan, Yamanashi Prefecture, Kitatsuru-gun, Kosuge-mura, under stones |
| Cy189 | Nesticus shinkaii | MT524192* | Japan, Tokyo Prefecture, Akiruno-shi, Yozawa. Otake Cave (大岳鍾乳洞) |
| Cy191 | Nesticus gondai | MT524191* | Japan, Gunma Prefecture, Annaka-shi, Sakamoto, Matsuida-machi, Kirizumi-gawa river valley, near Kirizumi onsen |
| Cy183 | Cyclocarcina floronoides tatoro | MG201049 | Japan, Gunma Prefecture, Tano-gun, Kanna-machi, Kagahara, Mt. Tatoro, Tatoro Cave (立処山鍾乳洞) |
Family Nesticidae Simon, 1894
Genus Nesticus Thorell, 1869
Nesticus latiscapus kosodensis Yaginuma, 1972: 295, f. 20–23 (♂♀).
N. latiscapus kosodensis Yaginuma, 1977: 315, pl. 2, f. 4 (♂).
N. latiscapus kosodensis
Yaginuma, 1979: 265, pl. 7, f. 2, 4 (♂♀).
Holotype. Japan – Honshu Island • ♂; Yamanshi Prefecture, Kitatsuru-gun, Tabayama-mura, Kosode Limestone Cave (小袖鍾乳洞); [35.7938N, 138.9722E]; 3 Feb. 1969, Akama H. leg.; NSMT-Ar 70 (as N. latiscapus kosodensis).
Paratype. Japan – Honshu Island • 1♀; same data as the holoype; NSMT-Ar 71 (as N. latiscapus kosodensis).
Japan – Honshu Island • 4♂♂, 3♀♀; Kitatsuru-gun, Kosuge-mura, Hashitate, Odaki (雄滝); 35.74476N, 138.88462E; 10 Nov. 2019, Suzuki Y. leg.; under stones; YSPC, FBPC • 4♀♀; Tokyo Prefecture, Nishitama-gun, Okutama-machi, Nippara, Nippara Limestone Cave (日原鍾乳洞); 35.8524N, 139.0407E; Ballarin F. leg.; FBPC.
Species closely related to Nesticus latiscapus, but both sexes can be distinguished by the morphology of the genitalia. Male N. kosodensis stat. nov. can be separated from male N. latiscapus by the following combination of characters: Dp2 and Dp3 close to each other (separated from each other in N. latiscapus, see Fig.
Male. Total length: 4.00–4.29, carapace: 1.77–2.01 long, 1.04–1.75 wide (based on three males).
Habitus as in Fig.
Palp as in Figs
Female. Total length: 3.73–3.90, carapace: 1.61–1.73 long, 1.46–1.47 wide (based on two females).
Habitus as in Fig.
Epigyne and vulva as in Figs
Endemic to central Honshu, Japan (Yamanashi and Tokyo Prefectures). See Fig.
Nesticus latiscapus Yaginuma, 1972: 291, f. 16–19 (♂♀).
N. latiscapus
Yaginuma, 1979: 264, pl. 7, f. 1, 3 (♂♀).
Holotype. Japan – Honshu Island • ♂; Yamanashi Prefecture, Minamitsuru-gun (former Kamikuishiki-mura), Aokigahara, Shoji-o-ana cave, Nichi-do cave (精進御穴日洞); [35.4709N, 138.6385E]; 2 Nov. 1969, Ueno S. & Kato K. leg.; NSMT-Ar 61.
Paratype. Japan – Honshu Island • 1♀; same data as the holotype; NSMT-Ar 62.
Japan – Honshu Island • 1♂, 2♀♀; Fujikawaguchiko-machi, Saiko Bat Cave (西湖蝙蝠穴); 35.4942N, 138.6714E; 09 Oct. 2014; Ballarin F. leg.; FBPC • 1♂, 2♀♀; same locality, Ryugu Doketsu Cave (龍宮洞穴); 35.4855N, 138.6683E; 09 Oct. 2014; Ballarin F. leg.; FBPC • 1♀; same locality, Narusawa Ice Cave (鳴沢氷穴); 35.4745N, 138.6665E; 10 Oct. 2014; Ballarin F. leg.; FBPC • 1♀; same locality, Fugaku Wind Cave (富岳風穴); 35.4775N, 138.6571E; 10 Oct. 2014 • 3♂♂, 2♀♀, Narusawa-mura, unnamed lava tunnel; 35.4749N, 138.6831E; 01 Apr. 2019; Ballarin F. leg.; FBPC • 1♂, 1♀; Narusawa area, 18 Aug. 2017, Suguro T. leg; TSPC.
See diagnosis of N. kosodensis stat. nov.
Male. Total length: 3.86–4.30 carapace: 1.87–2.02 long, 1.58–1.81 wide (based on three males).
Habitus as in Fig.
Palp as in Figs
Female. Total length: 3.91–4.43, carapace: 1.68–1.72 long, 1.47–1.59 wide (based on three females).
Habitus as in Fig.
Epigyne and vulva as in Figs
Endemic to the Fuji Mountain area in central Honshu, Japan (Yamanashi Prefecture). See Fig.
Phylogenetic relationship among Nesticus latiscapus (= red), N. kosodensis stat. nov. (= green), and other closely-related species from the same geographic area (=black) inferred from ML analysis of COI partial sequence. Branch lengths are scaled in relation to the number of substitutions per site. Numbers at nodes denote maximum likelihood bootstrap support.
Although lacking deep morphological adaptations to a strict hypogean lifestyle, both N. kosodensis stat. nov. and N. latiscapus share a clear preference for troglophilic habitats, being mainly found in the twilight zone of caves or other similar environments. N. latiscapus inhabits the lava tubes located in the Aokigahara area and other surroundings northwest of Mount Fuji, thus apparently preferring this typology of basaltic superficial caves rather than the more common limestone caves. N. kosondensis stat. nov. seems to dwell in a wider range of subterranean or semi-subterranean habitats along the southern area of Okuchichibu Mountains Region, from large limestone caves to deep rocks cracks and large, empty spaces under stones and screes. Despite neighboring each other, these species seem to have an allopatric distribution, their ranges being approximately 30 km far from each other (
All Japanese nesticids subspecies are currently know from sporadic records only, being limited to one cave (C. floronoides notoi, C. floronoides tatoro, N. longiscapus awa, N. longiscapus draco, N. tosa iwaya, N. tosa niyodo) or just few localities from a restricted area (C. floronoides komatsui, Nesticus akiyoshiensis ofuku) (
Endemic subterranean organisms, including cave spiders, are considered a priority target for species conservation since they are prone to extinction due to local or global environmental changes (
Incorrectly defining a valid species as a subspecies may underestimate the biodiversity of a cave, and thus fail to identify biodiversity hotspots and potentially endangered species. In turn, efforts spent for their protection may be insufficient, potentially causing the loss of endemic organisms even before they are discovered. On the other hand, correctly evaluating the existence of geographic variants of widely-distributed species may enable more efficient and effective prioritization in conservation projects. Widely-distributed organisms are often less vulnerable than endemic taxa, and have lower conservation priority (Primack 2006). Using limited economic resources to protect least concern species may distribute funding away from more threatened species.
Revising the taxonomic position of long-established and uncertain subspecies, like in the case of the Japanese nesticid spiders, can therefore be worthwhile in terms of conservation, especially in countries hosting several unique endemic species like Japan.
Both morphological and molecular analysis suggest that N. latiscapus is distinct from N. kosodensis stat. nov., rejecting the status of subspecies for N. kosodensis stat. nov. In the light of these results, the elevation of N. kosodensis stat. nov. to the rank of species is herein proposed. Our results further highlight that future work should investigate the remaining Japanese nesticid subspecies, as well as other spider subspecies, including from a conservation perspective.
It is likely that new, detailed studies involving both morphological and molecular comparison may lead to the rise of more of these interspecific ranks to valid species, thus further increasing the already high diversity of the family Nesticidae in Japan, and Japanese cave fauna in general. Such result may also help to promote new and more correct conservation plans to preserve the endemic cave spider fauna in Japan.
The authors are particularly grateful to Katsuyuki Eguchi for providing the use of microscope and other facilities at the Systematic Zoology Laboratory, Tokyo Metropolitan University, and to Ryosuke Kuwahara for the photograph of male N. kosodensis stat. nov. Many thanks to Marta Quitián, Isaac Planas-Sitjà, Tatsumi Suguro and Takeshi Yamasaki for helping with the field collections and providing additional material used in this study. We also thank Ken-ichi Okumura for allowing us to study the type material preserved in the National Museum of Nature and Science, Tokyo, Japan. Many thanks to Victoria Smith (Canterbury Museum, New Zealand) for checking the English text of an early draft of the manuscript. We are thankful to Akio Tanikawa, Takeshi Yamasaki and an anonymous reviewer for their suggestions which helped to improve the manuscript. This work was supported by the YF2018 Japan Society for the Promotion of Science (JSPS KAKENHI n°18F18380) Postdoctoral Fellowships, Japan.