Research Article |
Corresponding author: Joanna Kocot-Zalewska ( joannakocotzalewska@gmail.com ) Academic editor: Arnaud Faille
© 2021 Joanna Kocot-Zalewska, Paweł J. Domagała, Barbara Lis.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Kocot-Zalewska J, Domagała PJ, Lis B (2021) Living in isolation for almost 40 years: molecular divergence of the 28S rDNA and COI sequences between French and Polish populations of the cave beetle Speonomus normandi hydrophilus (Jeannel, 1907). Subterranean Biology 37: 75-88. https://doi.org/10.3897/subtbiol.37.54720
|
The paper gives the results of the first studies on the molecular divergence between native and non-native populations of Speonomus normandi hydrophilus (Jeannel, 1907). This species is endemic to Massif Arize in the Central Pyrenees (France), and represents highly specialised organisms that live underground. In 1982, one hundred specimens of S. normandi hydrophilus had been experimentally introduced into the Dzwonnica Cave (Poland). Since then, a numerous population has developed in the Towarna-Dzwonnica cave system, and the neighbouring Cabanowa Cave. After almost 40 years of isolation between native and non-native populations, the genetic variations were examined using the COI and 28S rDNA genes. Analyses of the haplotypes of 28S showed one common haplogroup, which confirms the origin of the Polish group. The differentiation of haplotypes for the COI marker was high for both the French and Polish populations. Altogether 18 haplotypes of this marker have been detected, 12 in the French population and 9 in the Polish. However, only a portion of the haplotypes is shared between the native and introduced population.
Coleoptera, intentionally introduced species, mitochondrial DNA, nuclear DNA, population genetics, troglobites
Recently, due to human activities, such as high-speed transport systems and increased shipping, insect species are moving across ecosystems, countries, and continents (e.g.,
Although the role of isolation in natural populations of cave-dwelling invertebrates has been estimated several times (e.g.
In the present paper, we provide results on the genetic divergence between native and introduced populations of a cave beetle Speonomus normandi hydrophilus (Jeannel 1907), which was intentionally transferred from the French Central Pyrenees to a cave in Poland (
S. normandi hydrophilus is a troglobitic species endemic to the Central Pyrenees in France and native populations have been studied by
The Bastardech cave “Gouffre de Bastardech” (Ariège) is a small cave with a steep entrance that lies in the Central Pyrenees (France) at an altitude of 630 m a.s.l. (Fig.
The Dzwonnica cave, where specimens of S. normandi hydrophilus were intentionally introduced, lies in the northern part of the Kraków-Częstochowa Upland, Poland (Fig.
Speonomus normandi hydrophilus (Jeannel 1907) (Coleoptera: Leiodidae), belongs to the tribe Leptodirini, which contains about 900 species (
In 1982, Skalski collected 50 males and 50 females of this species from the Bastardech cave in the French Pyrenees. These specimens of both sexes were separately inserted into a thermos with ice transported to Poland in two boxes containing cheese. Subsequently, they were introduced to the deep zone of the Dzwonnica cave in Poland. After 12 years, Skalski published that specimens of S. normandi hydrophilus had adapted to a new environment and descendants were frequently observed near the place of introduction (
A total of 100 individuals of S. normandi hydrophilus, 50 specimens in the Towarna-Dzwonnica caves system (Poland, 49°14'11"N, 19°51'52"E) and 50 specimens in Bastardech Cave (France, 42°57'38"N, 1°14'30"E) were collected by direct searching. In the Bastardech Cave, one week before the sampling, cheese was put onto the cave floor as bait. In the Towarna-Dzwonnica cave system specimens were collected directly without any bait. All samples were stored in 96% ethanol at -20 °C.
The 549 bp COI fragment was amplified using primer pair Pat and Jerry (
Marker | Primer name | Sequence (5' → 3') | Source |
---|---|---|---|
28S | Ka | ACACGGACCAAGGAGTCTAGCATG |
|
Kb | CGTCCTGCTGTCTTAAGTTAC |
|
|
COI | Jerry | CAACATTTATTTTGATTTTTTGG |
|
Pat | TCCAATGCACTAATCTGCCATATTA |
|
The total genomic DNA was extracted from thorax muscle tissues using a Sherlock AX kit (A&A Biotechnology) following the manufacturer protocol PCR amplifications were performed in a volume of 50 μl using ready-to-use mix PCR Mix Plus (A&A Biotechnology) and primer pairs.
The PCR reaction for the 28S rDNA consisted of initial denaturation for 3 min at 95 °C, followed by 34 cycles of 15 sec at 94 °C, 30 sec at 50 °C, and 40 sec at 72 °C. The final elongation step was 7 min at 72 °C. PCR amplification of the COI consisted of initial denaturation for 3 min at 94 °C, followed by 34 cycles of 30 sec at 94 °C, 30 sec at 50 °C, 45 sec at 72 °C, and final elongation for 10 min at 72 °C.
The purification of amplicons and sequencing were performed at A&A Biotechnology, Gdynia, Poland. All sequences were obtained in the forward and reverse directions. The obtained sequences were checked using the BLAST tool (https://blast.ncbi.nlm.nih.gov/) to detect possible contamination. All received sequences showed high similarities to sequences of S. normandi hydrophilus already deposited into GenBank. The sequences were deposited in GenBank under accession numbers: MW187125–MW187145 and MW187545–MW187565 for the 28S gene and MW187329–MW187352 and MW187448–MW187476 for the COI gene.
Each obtained sequence was manually edited for accuracy using FinchTV v. 1.4.0 (Geospiza Inc.) and aligned using ClustalW (with default parameters) in the MEGA X software (
We successfully obtained 42 sequences (549 bp) of the 28S rDNA and 53 sequences (549 bp) of the COI. In total, 18 haplotypes of the COI were identified among the analyzed specimens. The native Pyrenean population was characterized by 12 different haplotypes, whereas the Polish had nine. Overall, the haplotype diversity of the COI gene (hd) for all specimens was 0.8287 and was 0.8005 for the native French population and 0.8442 for the Polish one.
The average number of nucleotide differences (k) was 5.492, 5.428, and 5.558 for all specimens, the French, and the Polish population, respectively. The total number of the mutations (TM) of all analyzed sequences was 25 and was 21 and 17 for the native Pyrenean population and the Polish one, respectively. All obtained genetic diversity indices of the COI gene are presented in Table
Genetic diversity indices of the COI gene calculated for the studied specimens.
Population | ns | H | hd | S | V | ND | TM | k | Tajima’s D: |
---|---|---|---|---|---|---|---|---|---|
All | 53 | 18 | 0.8287 | 25 | 25 | 0.01000 | 25 | 5.492 | -0.00998 |
France | 29 | 12 | 0.8005 | 21 | 21 | 0.00989 | 21 | 5.428 | 0.00989 |
Poland | 24 | 9 | 0.8442 | 17 | 17 | 0.01012 | 17 | 5.558 | 0.79194 |
In the case of the nuclear 28S rDNA subunit, three haplotypes were identified, among them, three were detected in the Pyrenean population and a single haplotype within the Polish one. Overall, the haplotype diversity of the 28S rDNA (hd) for all analyzed specimens was 0.180. The native French population was characterized by a diversity value of 0.338, while the introduced population had no haplotype diversity. The average number of nucleotide differences (k) was 0.184 for both populations and was 0.352 for the French population. There were no nucleotide differences detected within the Polish population of the 28S rDNA marker. The total number of mutations (TM) was two in the Pyrenean population. No mutations were detected among the population introduced to the Dzwonnica cave in Poland. All obtained genetic diversity indices of the nuclear 28S rDNA marker are presented in Table
Genetic diversity indices of the 28S marker calculated for the studied specimens.
Population | ns | H | hd | S | V | ND | TM | k | Tajima’s D: |
---|---|---|---|---|---|---|---|---|---|
All | 42 | 3 | 0.180 | 2 | 2 | 0.00033 | 2 | 0.184 | -1.12813 |
France | 21 | 3 | 0.338 | 2 | 2 | 0.00064 | 2 | 0.352 | -0.84329 |
Poland | 21 | 1 | 0.000 | 0 | 0 | – | 0 | 0.000 | * |
The genetic distance between populations for nuclear 28S rDNA and mitochondrial COI markers are presented in Table
Average pairwise genetic distance, based on the p-distance method, of 28S and COI sequences.
Marker | Population | Overall average pairwise genetic distance |
---|---|---|
28S | France | 0.0009715 |
Poland | 0.0000000 | |
All | 0.0003343 | |
COI | France | 0.0098881 |
Poland | 0.0101238 | |
All | 0.0100037 |
The haplotype network generated for 28S gene demonstrate presence of one haplogroup. The most common haplotype (Hap 1) is present in all specimen from Poland, three from France and specimens sequences obtained from GenBank HG915551.1 and AM229403.1 (specimens from Riverenert, not far from Bastardech cave).
The haplotype network analysis for COI gene reveals two distinct haplogroups separated by seven mutational changes. The largest haplogroup (Haplogroup 1) contains 14 different haplotypes and is divided into two subgroups. The subgroup 1 contains the most common haplotype (Hap 2) which is shared among ten specimens from France, seven from Poland and one specimen obtained from GenBank (HG915401.1), from Riverenert. The second subgroup of Haplogroup 1 contains haplotype (Hap 8) which is shared among six specimens from Poland and one from France. The second haplogroup contains the second most common haplotype (Hap 3) which is shared among nine specimens from France and four from Poland. The haplotype Hap19 is referred to the sequence obtained from GenBank LN849271.1, from a cave (Ruisseau souterrain d´Aulot, Saint Girons) located ca 7 km from Bastardech cave in a straight line.
The introduction of S. normandi hydrophilus to a new environment is not the first experiment of its kind. In the 20th century, many cavernicolous species were experimentally introduced to new caves (
The molecular analyses were carried out using one mitochondrial and one nuclear marker, similar to other studies on genetic variation between closely related species (for example,
The results obtained in this study showed that nuclear 28S is less diverse than mitochondrial COI, which is unsurprising. Three haplotypes of the 28S marker were detected in the French population but only one in the Polish. Analyses of the haplotype network (Fig.
Median-joining haplotype network for 28S sequences. Different colours correspond to geographic origin and circle size is proportional to the number of individuals with the same haplotype. The number of individuals with a specific haplotype is in a circle. Hatch marks along edges represent the number of mutations between nodes.
The variations of haplotypes for the COI marker was high for both the French and Polish populations (0.80 and 0.84, respectively). The most common haplotypes were Hap 2 and Hap 3, which were shared between specimens from both populations (Fig.
Median-joining haplotype network for COI sequences. Different colours correspond to geographic origin and circle size is proportional to the number of individuals with the same haplotype. The number of individuals with a specific haplotype is in a circle. Hatch marks along edges represent the number of mutations between nodes.
The high variability in the French population might be explained by the fact that Speonomus normandi hydrophilus inhabits caves and the mesovoid shallow substratum in an area of c.a. 30 × 40 km (
The high diversity of the COI marker among the native population indicates that founder specimens transplanted to Polish cave were also diversified. Currently, the Polish population shares only a portion of the haplotypes with the native French population. Moreover, the presence of specific Polish population haplotypes may be the result of adaptation. Microevolutionary changes in the mtDNA could be stress-induced (
The total number of mutations in the COI was 25, and it was almost equal in both the French and Polish groups (21 ver. 17, respectively). Tajima’s D statistic is positive when there is an excess of high-frequency mutations, for example, after a population contraction or under balancing selection. Tajima’s D statistic is negative when there is an excess of low-frequency mutations, for instance, after a population expansion, a recent selective sweep, weak negative selection, or when samples come from an admixed population (
With the observed lower number of haplotypes in the introduced population, the obtained results were not surprising. In the research of Li et al. (2011), five populations of silver carp (Hypophthalmichthys molitrix) were compared between native (China) and introduced (USA, Hungary) habitats. All native populations had a higher variety of haplotypes in comparison to non-natives. Compared to another study on introduced species, a low genetic variation was observed. The amphibian species Eleutherodactylus johnstonei (Barbour 1914) was introduced from the Caribbean to Colombia 25 years ago. The recent study, based on two mitochondrial markers, has shown very low genetic variations within the implanted population. There was no variation in 12S rRNA and three haplotypes in the D-loop marker were detected. Interestingly, the two recorded haplotypes diverged by one and two mutations from the most common haplotype (
Gene flow is not always strongly limited between subterranean populations. In a cave cricket from the Rhaphidophoridae family, Dolichopoda schiavazzii Capra, 1934, twelve populations from caves and man-made subterranean environments in the Apennine Peninsula, as well as on the islands Elba and Pianosa, were studied (
The obtained results support a widely accepted theory that underground living species, as well as introduced ones, have a lower genetic variation in comparison to ancestral populations. For a better understanding of changes that have recently occurred in the introduced Speonomus normandi hydrophilus, it seems necessary to use microsatellite markers or NGS technology (
We are grateful to Dr. Olivier Guillaume from the Theoretical and Experimental Ecology Station for helping us to collect specimens of S. normandi hydrophilus from the Bastardech Cave. We are also thankful to Prof. J.A. Lis for all suggestions, remarks, and help in preparing the manuscript. Our great appreciation to Dr. Arnaud Faille for very insightful comments and help in improving the manuscript.