Research Article
Print
Research Article
 Coframalaxius bletteryi gen. et sp. nov. from subterranean habitat in Southern France (Hemiptera, Fulgoromorpha, Cixiidae, Oecleini)
expand article infoMaxime Le Cesne‡§, Thierry Bourgoin§, Hannelore Hoch|, Yang Luo‡§, Yalin Zhang‡
‡ Northwest A&F University, Shaanxi, China
§ Muséum national d’Histoire naturelle, Paris, France
| Museum für Naturkunde Berlin, Berlin, Germany

Corresponding author: Thierry Bourgoin ( thierry.bourgoin@mnhn.fr )

Corresponding author: Yalin Zhang ( yalinzh@nwsuaf.edu.cn )

Academic editor: Oana Teodora Moldovan
© 2022 Maxime Le Cesne, Thierry Bourgoin, Hannelore Hoch, Yang Luo, Yalin Zhang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Le Cesne M, Bourgoin T, Hoch H, Luo Y, Zhang Y (2022)  Coframalaxius bletteryi gen. et sp. nov. from subterranean habitat in Southern France (Hemiptera, Fulgoromorpha, Cixiidae, Oecleini). Subterranean Biology 43: 145-168. https://doi.org/10.3897/subtbiol.43.85804
ZooBank: urn:lsid:zoobank.org:pub:4D73DEA3-FE14-46A2-A689-FE5CEE4B760E
Open Access

Abstract

A new planthoppers genus and species of Cixiidae Oecleini, Coframalaxius bletteryi gen. et sp. nov. newly discovered in a cave near Nice in southern France, is described. Molecular analysis confirms the morphology-based classification of Coframalaxius as sister to Trigonocranus within the Oecleni. Several morphological characters are further discussed. A double-grasping coxo-femoral and femoro-tibial system is regarded as apomorphic for the oecline taxa and would allow the nymph to firmly grab the roots and rootlets on which it feeds or use to progress in the soil. Wing vein patterns are discussed in the Cixiidae: 1) for the forewings, Oecleini belong to the trifid type of the anterior MP branch, leading to the reinterpretation of some recently described Neotropical species, 2) for the hindwing, four connection types (U-, V-, Y- and I-types) between MP and CuA are described. Oecleini belongs to I-type with a complete fusion of MP3+4 with CuA1. Although the area where the cave is located is well-studied with respect to its regularly sampled epigean fauna for many years, the taxon is new to science, highlighting its probable completely hypogean life cycle and leading to consider Coframalaxius bletteryi as an eutroglophile species.

Keywords

Cave, ethology, morphology, planthoppers, wax plates, wing venation

Introduction

As obligate phytophagous insects, planthoppers (Hemiptera, Fulgoromorpha) would not be expected to live in caves. However, the root system of the aerial vegetation offers root-feeding planthoppers the opportunity to eventually adapt and evolve in temporary, cyclical or even permanent hypogean conditions. Since the first report by Racovitza (1907), more than 60 planthopper species in five planthoppers families (Cixiidae Spinola, 1839, Delphacidae Leach, 1815, Meenoplidae Fieber, 1872, Kinnaridae Muir, 1925, and Hypochthonellidae China & Fennah, 1952), have been reported living exclusively in the subterranean ecosystems (Hoch 1994; Hoch 2013, and references therein; FLOW 2022). According to their biology, they have been classified as true cavernicolous species or troglobionts, eutroglophiles (species able to maintain permanent hypogean populations), subtroglophiles (species living temporally or cyclically in hypogean conditions) and trogloxenes (species occurring sporadically in a hypogean habitats, unable to establish subterranean stable populations) (Sket 2008; Howarth and Moldovan 2018).

Although several hypogean species have been reported from the Macaronesian islands (Canary Islands, Azores, Cape Verde) and the Baleares (Mallorca: unconfirmed record; Racovitza 1907), in continental Europe, true cavernicolous species remain exceptional. One species of Kinnaridae, Valenciolenda fadaforesta Hoch & Sendra, 2021, was recently described from two karstic caves of the Iberian Mountain Range in Spain (Hoch et al. 2021). The other two are Cixiidae Cixiini: Ibleocixius dunae D’Urso & Grasso, 2009, described from Sicily from a limestone cave (d’Urso and Grasso 2009) and Trirhacus helenae Hoch, 2013, from a dolomite cave in Mljet island, Croatia (Hoch 2013). In the adult stage, they all have more or less strong morphological adaptations to underground life and as troglobionts, they are are adapted to the stabilize conditions they experience underground.

Only few planthoppers are considered eutroglophiles and subtroglophiles, which are less strongly linked to hypogenous habitats (FLOW 2022). In Europe, another Oecleini monotypic cixiid genus, Trigonocranus Fieber, 1875 with the species Trigonocranus emmeae Fieber, 1876, should be regarded as a subtroglophilic species (Hoch et al. 2013). It is a rarely collected species known from few localities in northern parts of western Europe and Russia and seems to inhabit the interstitial ground level. Adults often exhibit varying degrees of certain troglomorphies such as reduction of the compound eyes, wings and weak pigmentation (Hoch et al. 2013).

Following Emeljanov’s subdivisions (2002), the classification of the Cixiidae was recently reviewed by Luo et al. (2021) who recognized three main lineages (but without formal rank while awaiting further phylogenetical analysis): the oecleine lineage (including Duiliini Emeljanov, 2002, Cajetini Emeljano, 2002, Stenophlepsini Metcalf, 1938, Oecleini Muir, 1922, and Bothriocerini Muir, 1923 downgraded from subfamilial rank), sister to a pentastirine (with Pentastirini Emeljanov, 1971 and perhaps Borysthenini Emeljanov, 1989, downgraded from subfamilial rank) and a cixiine lineage (including all other cixiid tribes). Three tribes were not addressed by Emeljanov (2002): Gelastocephalini Emeljanov, 2000, Mnemosynini Emeljanov, 1992 and Benarellini Emeljanov, 1989). In this paper, we describe a new genus of Cixiidae in the tribe Oecleini, for a new species recently discovered in a cave in southern France. A molecular analysis confirms its placement in the Oecleini. This species has the classic nymphal troglomorphies present in most species of the family and adults look like typical epigeal species. However this planthopper has never been observed in any habitat above ground, even though the area where the cave is located has been well investigated with respect to its epigean fauna over many years. Accordingly, the ecological classification of the new species is discussed.

Materials and methods

Specimens were collected by hand with an aspirator and killed in cyanide jars. All specimens are stored dried on cardboard in the Muséum national d’Histoire naturelle, Paris, France (MNHN). Each label under a specimen is reported between brackets: [label1][label2]... For descriptive purposes, entire nymphs or adult abdomens were boiled in 10% NaOH solution for a few minutes. Residual endodermic soft tissues were removed in distilled water before transferring the whole abdomen into glycerin for dissection and observation. Dissected nymphs, abdomen parts and genitalia were stored under their related specimens in genitalia vials in a drop of glycerin for final conservation. Preparation and observation of specimens were done under a Leica MZ12.5 stereo microscope. Photos were taken either with the adapted module Leica IC90E and Leica Acquire software (version 2.4.6 Build 9112), either with a Canon EOS 6D with a Macrolens Canon EF 100 mm f/2.8, and then assembled with the software Helicon focus 6.

Morphological terminology for male genitalia follows Bourgoin (1988), for female genitalia Bourgoin (1993), and forewing venation Bourgoin et al. (2015). Terminology of vertex is adapted from Loecker (2014: Fig. 1) and follows Fig. 2. The metatibiotarsal formula lT-(aTd)/aI/aII corresponds to the number of lateral (lT) and apical teeth (aT) on the metatibia, eventually with a diastema (d), the number of apical teeth (aI) on metatarsomere I, and the number of apical teeth (aII) on metatarsomere II.

Total genomic DNA was extracted from legs muscle tissue using the Qiagen DNEasy kit (Qiagen, Inc., Valencia, CA, USA). Analyses were conducted on partial sequences of 18SrDNA (1939 bp; first third of the gene not sequenced), 28SrDNA (D3-D10; 3057 bp), cytochrome oxydase I (COI; 1239 bp), cytochrome b (Cytb; 426 bp), and histone 2A (H2A; 306 bp). Oligonucleotide primers used for polymerase chain reaction (PCR) amplification are listed in Table 1. The full dataset includes 37 taxa: 3 delphacids as out-group taxa and 34 ingroup taxa representing all three subfamilies of the Cixiidae (Borystheninae, Bothriocerinae, Cixiinae). All species available to us from the oeclinian lineage sec. Luo et al. 2021, were included; 29 species were directly available from Genebank of which we added 8 new samples. All related registration numbers in GenBank are provided in Table 2.

Phylogenetic reconstruction using maximum likelihood (ML) was generated in Phylip formats using PhyloSuite V1.2.1 (Zhang et al. 2020). The best partitioning scheme and replacement model were selected by PartitionFinder V2.0.0 (Lanfear et al. 2016), resulting in 9 partitions fitting 6 best models (Table 3). Maximum likehood (ML) analysis were carried out with IQTREE V1.6.8 (Guindon et al. 2010; Minh et al. 2013; Nguyen et al. 2015). The resulting topology was prepared with iTOL v5 (Letunic and Bork 2021).

Figure 1. 

Coframalaxius bletteryi in its natural habitat A cave with roots B roots with cixiid nests characterized by the waxy filaments left by the nymphs C waxy galleries where nymphs and adults were observed D fifth instar nymph feeding on rootlet E adult and nymph inside nest.

Figure 2. 

Coframalaxius bletteryi gen. et sp. nov. head capsule A dorsal B frontal C dorsofrontal and lateral view. Scale bar: 0.5 mm.

Table 1.
Download as
CSV
XLSX

Primer sequences used for the molecular analysis.

Primer Sequence (5’ – 3’) Primer Source
COI
2183 (F) CAACATTTATTTTGATTTTTTGG Simon et al. (1994)
UEA8 (R) AAAAATGTTGAGGGAAAAATGTTA Lunt et al. (1996)
Cytb
CB1 (F) TATGTACTACCATGAGGACAAATATC Jermiin and Crozier (1994)
CP2 (R) CTAATGCAATAACTCCTCC Harry et al. (1998)
18S rDNA
574 (F) GCCGCGGTAATTCCAGCT Bourgoin et al. (1997)
E21 (R) CTCCACCAACTAAGAACGG
18S–mid (F) GATACCGCCCTAGTTCTAACC
2200 (R) CGGCAGGTTCACCTACGG
28S rDNA
Ai (F) GACCCGTCTTGAAACACG Litvaitis et al. (1994)
D4D5r (R) GTTACACACTCCTTAGCGGA Belshaw and Quicke (2002)
EE (F) CCGCTAAGGAGTGTGTAA Cryan et al. 2000
MM (R) GAAGTTACGGATCTARTTTG
Lalt (F) CCTCGGACCTTGAAAATCC Dietrich et al. 2001, as ‘fragment IV
Galt (R) TGTCTCCTTACAGTGCCAGA
V (F) GTAGCCAAATGCCTCGTCA Cryan et al. 2000
X (R) CACAATGATAGGAAGAGCC
H2A
F1 (F) TGTCTGGYCGCGGCAARGG Cryan & Urban, 2011
R1 (R) ACGGCCTGGATGTTGGGCA
Table 2.
Download as
CSV
XLSX

Investigated species, with their main distribution and registration numbers of sequenced genes. New sequences are marked with (*).

Species Distribution COI Cytb 18S 28S H2A
Cixiidae
Achaemenes intersparsus Jacobi, 1907 Madagascar EU183598 – EU183575 EU183704 –
Borbonomyndus pandanicola Attié, Bourgoin & Bonfils, 2002 Reunion Island EU183593 – EU183571 EU183735 –
Borysthenes sp.* China: Hunan ON079066 ON113340 ON087638 ON130260 –
Bothriocera eborea Fennah, 1943 US Virgin Island EU645971 – DQ532511 DQ532591 JN797395
Bothriocera sp.1 Martinique EU183603 EU183642 EU183577 EU183670 –
Bothriocera sp.2 Belize EU183604 – EU183581 EU183675 –
Coframalaxius bletteryi gen. et sp. nov. * France ON087562 ON113342 ON087640 ON231299 ON101633
Colvanalia sp.* China: Zhejiang – OK169309 MW306541 – –
Cixius bicolor Matsumura, 1914 * China: Taiwan – OK169315 MW306536 MW306556 ON101626
Cixius sp.* China: Shaanxi MW291679 ON152767 MW306516 MW306544 OK169342
Colvanalia taffini Bonfils, 1983 Vanuatu EU183613 – EU183560 EU183690 –
Haplaxius crudus (Van Duzee, 1907) USA (FL) EU183606 – EU183553 EU183680 –
Haplaxius deleter (Kramer, 1979) Costa Rica EU183605 EU183631 EU183552 EU183679 –
Haplaxius delta (Kramer, 1979) Costa Rica MT900602 – MT892908 – –
Haplaxius dougwalshi Bahder et al., 2020 Costa Rica MT080284 – MT002395 – –
Haplaxius lunatus (Van Duzee, 1909) USA (FL) OM264285 – OM258692 – –
Haplaxius pictifrons (Stål, 1802) Costa Rica MT946292 – MN200098 – –
Haplaxius sp. Costa Rica MW086873 – MW086509 – –
Haplaxius skarphion (Kramer, 1979) Mexico – – EU183570 EU183682 –
Meenocixius virescens Attié, Bourgoin & Bonfils, 2002 Reunion Island EU183614 EU183639 EU183572 EU183736 –
Myxia baynardi Bahder & Bartlett, 2021 Costa Rica MT900604 – MT892909 – –
Myxia belinda Bahder & Bartlett, 2020 Costa Rica MT900605 – MN200096 – –
Myxia hernandezi Bahder & Bartlett, 2021 Costa Rica MZ234085 – MZ262449 – –
Nymphocixia caribbea Fennah, 1971 Cuba EU183615 – EU183561 – –
Nymphocixia unipunctata Van Duzee, 1923 USA (FL) OM264284 – OM258690 – –
Oecleopsis tiantaiensis Guo, Wang & feng, 2009 * China: Hunan MW291684 – MW306535 MW306590 –
Oecleus mackaspringi Myrie et al., 2019 Jamaica MN488999 – MN422261 – –
Oecleus perpictus Van Duzee, 1929 USA(AZ) – – JQ982515 JQ982532 –
Oecleus productus Metcalf, 1923 USA – EU183647 – EU183719 –
Oecleus sp.2 USA (UT) EU645972 DQ532512 DQ532592 –
Oecleus sp.1 Belize – EU183649 – EU183662 –
Oliarus sp.* China: Guizhou MW291688 – MW306513 MW306564 –
Pintalia alta Osborn, 1935 US Virgin Island – – AY744804 AY744838 –
Trigonocranus emmae Fieber, 1876 * Belgium – – ON260952 – –
Delphacidae
Asiraca clavicornis (Fabricius, 1794) Kyrgyzstan AF304409 – HM017281 HM017389 –
Kelisia curvata Beamer, 1954 USA(PA) – – HM017235 HM017343 –
Ugyops stigmata (Crawford, 1914) Belize HM017501 – HM017301 HM017409 –

Taxonomy

Hemiptera Linnaeus, 1758

Cixiidae Spinola, 1839

Cixiinae Spinola, 1839

Oecleini Muir, 1922

Coframalaxius Bourgoin & Le Cesne, gen. nov.

http://zoobank.org/978AA57A-FCE2-45DC-8512-E555F327B1B

Type species

Coframalaxius bletteryi Le Cesne & Bourgoin (by present designation and monotypy).

Etymology

Arbitrary combination of the first syllabus of author (T. Bourgoin) four grandsons with suffix -xius from Cixius, type genus of the family Cixiidae.

Diagnosis

Small cixiids, in habitus resembling Trigonocranus Fieber, 1875, but can be distinguished from the latter by the combination of the following characters: 1) pygofer longer in lateral view, expanded in a triangular lobe on its latero-posterior margin, 2) anal tube with proximal pair of lateroventral teeth, 3) posterior part of gonostyli wider and 4) aedeagus with one internal spine-like process. Female pygofer elongated, without wax plates.

Description

Head capsule. Vertex with posterior compartment sub-rectangular, anterior compartment triangular; subapical carina straight weakly marked, apical carina well distinct, median carina weak vanishing at subapical carina level; in lateral view, slightly surpassing lateral carina. Frons wider at ventral level of antennae in frontal view; frontoclypeal suture slightly arched dorsally, median carina weak, distinct only in dorsal part and not reaching median ocellus; in lateral view, regularly convex, slightly surpassing laterofrontal carina. Postclypeus with lateral margins slightly concave in basal 1/3; in frontal view, median carina weak in ventral 2/3. Anteclypeus lacking median carina. Compound eye thinly elongated in dorsal view. Antennal socket wide, emarginated, almost touching ventral margin of compound eye; scape short, pedicel globular with distinct transversal margin in frontal view, flagellum with basal swelling well developed, almost five times as long as pedicel, surpassing in length the level of lateral side of abdomen (Fig. 2). Lateral ocelli present, separated from compound eye by 1X their length. Labium almost reaching metacoxae; apical segment 1/4 length of subapical one, slightly thinner medially, proximal segment half as long as subapical one.

Thorax. Prothorax anterior margin widely roundly concave (Fig. 2); posterior margin more sharply roundly concave (Fig. 2); median carina present, not reaching posterior margin; postocular carinae well distinct, not meeting posterior margin and running subapically to its ventral margin in frontal view (Fig. 2B, C). Mesonotum tricarinate with median and lateral carinae. Forewing elongated; stem ScP+R+MP slightly longer than basal cell length, forking at 1/4 of forewing length, before level of PCu+A1 fusion; anterior and posterior margins subparallel. C1 cell distinctly curved; anterior branch of MP (MP1+2) forking twice: in MP1 and MP2, then MP1a, and MP1b. Posterior branch MP3+4 single, unforked. C5 cell short, diamond-shaped, ending with CuA1+CuA2 fused; icu reaching apex of clavus (Fig. 3A). Hindwing with MP and CuA connecting in I-type (Fig. 3C).

Hindleg with metatibia laterally unarmed, with 6 apical teeth separated in two groups of 3 by a wide diastema, and outermost tooth largest; first metatarsomere elongate, not dilated apically, with 8–9 apical teeth; second metatarsomere with (7–8) apical teeth, without setae under the first one or two teeth on each side, with one long straight setae under the three to five medium teeth; metatibitarsal formula: 0-(3d3)/(8–9)/(7–8)

Table 3.
Download as
CSV
XLSX

Best partitioning schemes and models for maximum likelihood (ML) analysis.

Genes/codons in partition Model in IQtree
COI, 18S and 28S GTR+I+G
nt1 of H2A GTR+I
nt1 of Cytb GTR+G
nt2 and nt3 of Cytb K81UF+I+G
nt3 of H2A K81UF+G
nt2 of H2A K81
Figure 3. 

Wings of Coframalaxius bletteryi gen. et sp. nov. A tegmina venation pattern B variation of tegmina venation C hind wing venation pattern. Scale bars: 1 mm (A, C); 0.5 mm (B).

Male genitalia. Anal tube symmetrical, with an anterior pair of lateroventral conspicuous hook-like spines. Pygofer symmetrical, dorsocaudally produced into a triangular lobe; suspensorium developed, X-shaped, attached to ventral margin of anal tube (Fig. 4). Male copulatory organ with periandrium tube-like, elongated, bearing spines and processes. Aedeagus s.s. very short, endosoma not or very shortly developed. Gonostyli bilaterally symmetrical, with proximal portion slender, apically developed into a spoon-shaped extension with a nearly pentagonal outline, directed dorsally.

Female genitalia of orthopteroid type, sword-shaped ovipositor, following paired hemisternite VII medially divided by a membranous portion (Fig. 5). Pygofer of elongated type without ventral wax plate. Gonoplac fused, apically separated. Ductus receptaculi regular, short, not developed in a helix-twirled structure (Fig. 5C).

Nymphs. Two short laterometatibial spines in 5th instar (Fig. 6). With abdominal paired tergal wax plates on tergites VI to VIII divided into 6 subplates separated by one sensory pits, those ones ranged in raw in subanterior position (Fig. 6). In instars 3 to 5: procoxa with one sharp anterior process bearing small (sensorial?) dark triangular microcuticular sculptures; profemur with a conspicuous latero-extern process bearing a row of short sensorial setae-like structures, protibia short distally truncate, bearing two tarsomeres.

Figure 4. 

Coframalaxius bletteryi gen. et sp. nov. Male genitalia A pygofer lateral view B anal tube, dorsal view C suspensorium D, E male genitalia left lateral view F, G male genitalia apex, right side. Scale bar: 0.5 mm.

Figure 5. 

Coframalaxius bletteryi gen. et sp. nov. Female genitalia A, B ventral view C ectodermal internal ducts of female genitalia. Scale bar: 0.5 mm.

Figure 6. 

Coframalaxius bletteryi gen. et sp. nov. Fifth instar nymp A, B proleg, ventral view and anteroventral view C Sternite VI, wax plates. Scale bar: 0.5 mm.

Coframalaxius bletteryi Le Cesne & Bourgoin, sp. nov.

http://zoobank.org/BF08E58D-256F-4286-9CEB-4A87A736D384

Genebank registration

ON087562/ ON113342/ ON087640/ ON231299/ ON101633.

Etymology

Dedicated to Jonathan Blettery who discovered the first specimen during a fieldtrip with the two first authors exploring caves around Nice in the south of France.

Diagnosis

Small species externally similar to Trigonocranus emmeae Fieber, 1876, from which it can easily be separated by the triangular areolet of the vertex (versus pentagonal (Emeljanov 2015: 69 and fig.21.6) in T. emmeae), but also by the rounded posterior margin of the pronotum (versus angular), the conformation of the male genitalia with thinner spiniform processes also different in number and conformation and particularly by a unique internal distinct process inside the periandrium (Fig. 4).

Color

Compound eyes, post clypeus, areolet, anterior part of prothorax behind vertex and mesonotum black, frons paler and carinae yellowish-brown. Tegmina translucent without color patches, pterostigma and vein pale brown, with setiferous granules darker; veins after nodal line darker. Legs pale brown. Metatibia and metatarsomere teeth black, median spines of metarsormere II with setae paler.

Male terminalia with anal tube regularly ovoid, in dorsal view more or less regularly convex lateroventrally in lateral view with a pair of lateroventral teeth directed posteroventral. Male genitalia asymmetrical with suspensorium X-like, connected to the perandrium basally shortly wide then distally tube-like; bearing 5 spiniform processes: a very basal and dorsal short straight spiniform process (1), on left side a long proximal spiniform process directed dorsoposteriorly then bent posteroventrally (2), a short acute ventral process (3), an elongate dorsal spiniform process forked at mid length in a short teeth-like (4) and a short internal hook-like process, located inside the periandrium (5). Gonopore opening large on apical right side, endosoma not visible, probably very weakly developed.

Female terminalia (Fig. 5) with paired sternite VI; each gonocoxa VIII developed in a wide plate slightly bilobed lateroapically; gonapophyses IX fused, slightly larger than gonapophyses VIII; gonapophyses VIII larger proximally in a wide triangular endogonocoxal lobe; gonoplacs longer than gonapophyses and enveloping them. Opening of ectodermic internal parts with developed lateral swellings of vestibulum, opening into posterior vagina developed in a strong wrinkled membranous pouch on left side, opening dorsally into the ductus bursae leading to a membranous translucent bursa copulatrix, and laterally into the anterior vagina bent at mid length and ending in the spermatheca; spermatheca with pars intermedialis, half-length of anterior vagina, opening into a diverticulum ductus bent, followed by a long pars intermedialis before vanishing into the the mesodermic glandula apicalis.

Material type

Holotype male, pinned, original description: [Grotte de la chèvre d’or; Roquefort-less-Pins; France (06)], [12-VII-2021; J. Blettery rec.], [Coframalaxius bletteryi Le Cesne & Bourgoin sp. nov.; M. Le Cesne det. 2022], [MNHN(EH) 24997].

Paratypes : 1 female, pinned, with genitalia in a separate microvial, original label: [Grotte de la chèvre d’or; Roquefort-les-Pins; France (06)], [Coframalaxius bletteryi Le Cesne & Bourgoin sp. nov.; M. Le Cesne det. 2022], [MUSEUM PARIS; 12-VII-2021; T. Bourgoin rec.], [Museum Paris; MNHN(EH) 24998] ; 4 females, pinned, original label: [France, 06; Roquefort-les-Pins; grotte de la chèvre d’or],[MUSEUM PARIS; 12-VII-2021; T. Bourgoin rec.], [Coframalaxius bletteryi Le Cesne & Bourgoin sp. nov.; M. Le Cesne det. 2022], [Museum Paris; MNHN(EH) 25177, 25178, 25179, 25180] ; 2 males, pinned, with genitalia in a separate microvial, original label: [France, 06; Roquefort-les-Pins; grotte de la chèvre d’or],[MUSEUM PARIS; 17-VII-2021; M. Le Cesne rec.], [Coframalaxius bletteryi Le Cesne & Bourgoin sp. nov.; M. Le Cesne det. 2022], [Museum Paris; MNHN(EH) 25181, 25182] ; 3 males, pinned, original label: [France, 06; Roquefort-les-Pins; grotte de la chèvre d’or],[MUSEUM PARIS; 12-VII-2021; T. Bourgoin rec.], [Coframalaxius bletteryi Le Cesne & Bourgoin sp. nov.; M. Le Cesne det. 2022], [Museum Paris; MNHN(EH) 25183, 25184, 25185] ; 3 males, pinned, original label: [France, 06; Roquefort-les-Pins; grotte de la chèvre d’or],[MUSEUM PARIS; 12-VII-2021; J. Blettery rec.], [Coframalaxius bletteryi Le Cesne & Bourgoin sp. nov.; M. Le Cesne det. 2022], [Museum Paris; MNHN(EH) 25186, 25187, 25188].

Other material

Several other nymphs at various instars, pinned.

Type locality

Roquefort-les-Pins, Alpes-Maritimes, France

Phylogeny

Coframalaxius bletteryi was sequenced for: COI, Cytb, H2A, 18S and 28S (D3-D5, D6-D7), but only successfully sequenced for 28S (D6-D7) for Trigonocranus emmeae. Comparison between the two taxa shows significant differences in both total characters and base frequencies, that differs by 37 characters (4.4%) (Table 4). The resulting topology of the molecular analysis (Fig. 8) confirms the placement of Coframalaxius into Oecleini as sister to Trigonocranus.

Figure 7. 

Coframalaxius bletteryi gen. et sp. nov. Habitus photos.

Figure 8. 

Coframalaxius placement within Cixiidae by molecular phylogeny analysis. Out-groups in grey, Oecleini in blue, Bothriocerini in red. Node labels provide UFBoot support values.

Table 4.
Download as
CSV
XLSX

Summary of the sequence information of 28S (D6-D7) of Trigonocranus and Coframalaxius.

28S (D6-D7) Total characters Base frequencies (%)
A C G T
Trigonocranus emmeae 837 21.4 25.9 32.9 19.8
Coframalaxius bletteryi 830 21.6 25.1 33.1 19.4

Discussion

1. Coframalaxius classification in the Cixiidae Oecleini

According to Emeljanov’s 2002 classification, Coframalaxius can be excluded from the pentastirinian and cixiinian lineage (Luo et al. 2021) based on the presence of paired sternite VIII in males (versus unpaired), icu joining apex of clavus (versus displaced distal to apex of clavus), the laterally unarmed metatibia with the presence of a metatibial diastema (versus a more or less regular line of teeth), and an elongated female genitalia (versus reduced or short). All these characters, together with the head capsule conformation distinctly different from the Bothriocerini type, places the new genus within the Oecleini.

The placement of Coframalaxius in Oecleini is also confirmed by the molecular phylogeny analysis (Fig. 8) which puts it relatively close to its basal node in a strongly supported Palaearctic clade with Trigonocranus, both being sister to a La Reunion clade grouping Borbonomyndus Attié, Bourgoin & Bonfils, 2002, and Meenocixius Attié, Bourgoin & Bonfils, 2002. If the oecleine lineage appears well supported, the basal branching of the different groups of taxa (including Bothriocerini) remain weak and need further analysis, which is beyond the scope of this paper. Interestingly, the separation between the two genera Haplaxius Fowler, 1904 and the recently described Myxia Bahder & Bartlett, 2019, also needs more investigation. However, only 9 out of 25 curently recognized oecleine genera are present in the phylogenetic analysis. In particular, the genus Myndus Stål, 1862 is not represented, whereas, with its worldwide distributed 81 species (Bourgoin, 2022), it very probably represents a paraphyletic unit.

Our phylogenetic analysis posits a paraphyletic Oecleini, including Bothriocerini, rather than a sister relationship between the two tribes as suggested by Emeljanov (2002). However, the phylogenetic relationships of the oecline lineage and more specifically within the Oecleini (s. l.) will be addressed in another paper (Luo et al. in prep).

2. Morphological characters in support of placement of Coframalaxius into Oecleini

Nymphal prolegs

Myers (1929) first described the fossorial prolegs of the fifth instar of Bothriocera signoretti Stål, 1864 as did Wilson and Tsai (1982) and Wilson et al. (1983) of the fifth instars of the oecleines Haplaxius crudus (Van Duzee, 1907) and Oecleus borealis Van Duzee, 1912. Emeljanov (2002) mentioned the “thick and dentate fossorial forelegs” in nymphs as a possible characteristic of Bothriocerini, Oecleini, and probably Cajetini (because of their unique thick adult forelegs). Subsequently with his figure (Emeljanov 2002: fig. 12), he implied inclusion of Stenophepsiini in this group of tribes, but not of Duiliini.

Coframalaxius confirms this very special character as a probable morphological synapomorphy of the tribes mentioned by Emeljanov (2002). The structure of the prolegs was compared to the fossorial prolegs of cicada nymphs. We think the term “fossorial” is not appropriate, but the term raptor which Myers (1929) also mentioned is even less so. Based on the morphology of the proleg we suggest that it is more likely a double-grasping system (1) between the coxal apophysis and the femur, and (2) between the femoral apophysis and the tibia. This double-grasping mode would allow the nymph to firmly grab the roots and rootlets on which it feeds or use it to progress in the soil.

Forewing venation

In the Fulgoromorpha ground pattern (Shcherbakov, 1996; Bourgoin et al. 2015) the media vein of the tegmina forks once at the nodal line into and anterior branch and a posterior branch, both respectively forking again into MP1, MP2, and MP3, MP4 (Fig. 9A) As mentioned by Emeljanov (2002), a five MP branchs probably belongs to the ground plan of the Cixiidae, but occurring in two different patterns. In most cixiids, the trifid anterior branch of the media (M1+2) is realized by the first forking in MP1 and MP2 generally occurring between the nodal line and the submarginal line and the second forking of MP1 into MP1a and MP1b at or after the submarginal line (Fig. 9B). The fork of the posterior branch of the media (MP3+4) into MP3 and MP4 is generally part of the submarginal line. From this basic cixiid schema, a clear distinctive one with still five MP terminals but with a bifid anterior media branch (MP1, MP2) and a trifid posterior one (MP3 and MP4 forking into MP4a and MP4b) is present in Brixiini Emeljanov, 2002, Brixidiini Emeljanov, 2002 and some Mnemosynini (Emeljanov 2002) (Fig. 9C). Oecleini have the anterior trifide type (Fig. 9D). Often, individual asymmetrical variations occur in specimens, but this general pattern is more typical. In several genera, this pattern is often modified with a single posterior MP3+4 branch. Such a conformation is found in the following species:

Oecleus mackaspringi Myrie et al., 2019 (Myrie et al. 2019: Fig. 4 with MP3+4 misidentified as M2+3 and CuA1 and CuA2 misidentified as MP4 and CuA)

Myxia hernandezi Bahder & Bartlett, 2021 (Zumbado Echavarria et al. 2021: Fig. 3 with MP1a, MP1b, MP2 and MP3+4 respectively misidentified with MP1, MP2, MP3, MP4)

Myxia belinda Bahder et al., 2019 (Bahder et al. 2019) and M. baynardi Barrantes Barrantes et al. 2021B) (Barrantes Barrantes et al. 2021a) with Fig. 6 in both papers with MP1a, Mp1b, MP2, MP3+4, CuA1+CuA2 and icu respectively misidentified with MP1, MP2, MP3, MP4, CuA1 and CuA2.

In other oecleinian taxa a normal pattern is observed in Haplaxius dougwalshi Bahder et al., 2020, (Bahder et al. 2020) and H. pococo Bahder & Bartlett, 2021 (Barrantes Barrantes et al. 2021b), in the genus Bothriocera Burmeister, 1835, the amber fossil Bothriobaltia Szwedo, 2002 (Szwedo, 2002), Oecleus Stål, 1862 (Ball and Klingenberg 1935) and Borbonomyndus Attié, Bourgoin & Bonfils, 2002 (Attié et al. 2002). In Meenocixius Attié, Bourgoin & Bonfils, 2002 (Attié et al. 2002) an unusual late forkings of MP1+2 and MP3+4 at the submarginal line in a 4-terminal MP is observed.

Most oecleine genera exhibit a short diamond shaped C5, distally closed in a single stem of CuA1+CuaA2 fused in a short stem after the nodal line, or totally fused in a single terminal (Fig. 9D). In Borbonomyndus (Attié et al. 2002) and Bothriocera (Emeljanov 2002), CuA1 and CuA2 remains separated with a probable plesiomorphic elongated C5. These various patterns may be of specific or even generic value, but don’t seem stabilized at higher taxonomic rank.

Figure 9. 

General patterns of MP and CuA veins in planthopper tegmina from (A) ground plan (according to Shcherbakov, 1996; Bourgoin et al. 2015), of the probable cixiid plesiomorphic condition (B), and with inverted patterns of anterior and posterior MP branches (C) in Mnemosynini and Pintaliini, and Oecleini patterns (D) with CuA branches fused (in many Oecleini MP3 and MP4 are also fused into a single MP3+4 terminal branch).

Figure 10. 

Types of connections between MP and CuA veins in planthopper hindwings. General conformation and respective U-, V-, Y- and I-type observed in Cixiidae.

Hindwing venation

Emeljanov (2002), addressed the anastomosis of MP+ CuA in the hind wings of Cixiidae. Four types of connections between the two veins can be described (Fig. 10). The probable most plesiomorphic type or U-type (Fig. 10) shows the two veins still connected by a short mp-cua transverse veinlet as in Borysthenes (Emeljanov 2002, fig.6b). The punctate anastomosis between MP3+4 and CuA1 or V-type (Fig. 10) is found in Andes Stål, 1866 or Pentastiridius Kirschbaum, 1868, (Emeljanov 2002, fig. 5b, 6b), but a partial fusion of these two veins, or Y-type, seems to be more widely expressed in Cixiidae. The ultimate stage is the complete fusion of MP3+4 and CuA1 (Fig. 10 I-type) found in several genera of various tribes: Myndus Stål, 1862, Duilius Stål, 1858, Cajeta Stål, 1866, Pintalia Stål, 1862, Eucarpia Walker, 1857, ... (Emeljanov 2002). While a trend to the fusion of MP3+4 with CuA1 appears to be quite general in the family, it remains to be described in more genera to better appreciate if these different patterns carry further diagnostical or phylogenetical value. As in many other Oecleini, Coframalaxius belong to the I-type, together with the absence of forking of the anterior branch of the media.

Wax pore plates and associated sensory pits on abdominal termites VI–VIII in nymphs

Patterns of these tegumentary glands and sensory units were discussed by Emeljanov (1992), who later presented an evolutionary scenario of its transformation within the Cixiidae (Emeljanov 2002). He posited a five step morpholine with six types arising from a plesiomorphic type with the sensory pits anterior to the wax plates then becoming surrounded by the wax plates, then ultimately reduced to only one sensory pit surrounded by two smaller plates (Emeljanov 2002, fig.10). Coframalaxius is a good example of the intermediate type hypothesized by Emeljanov (2002): five sensory pits placed in the anterior row. However, another scenario where the Coframalaxius type, quite similar to the pentastirine one, could represent the plesiomorphic condition. It evolved on one side to an apomorphic condition for higher Oecleini taxa with the sensory pits migrated anteriorly to the wax plates (anteromarginal row in Haplaxius Fowler, 1904) and on the other side to the multiplication of the lateral sensory pits (Pentastirini) or the progressive fusion of the lateral wax plates with reduction of the sensory pits in the cixiinian lineage. As mentioned by Emeljanov (2002) the absence of better knowledge of nymphs of most cixiid tribes is distressing.

Metatibial spines

Two minutes lateral tibial spines are typical of cixiid early nymphs as in Coframalaxius (Fig. 6D). These spines were present in adult Cixiidae in various numbers, and their absence in adults is interpreted as apomorphic by Emeljanov (2000, 2002) according to his hind leg “disarmament evolutionary scenario”. They are absent in adult oecleines with the exception in the cave genus Confuga Fennah, 1975, in which six minute lateral spines are found (Santos et al. 2019: fig. 8). This condition might be linked to the cave-living adaptation of this species by retention of a nymphal condition in the adult. Lateral spines are present in the other adult cixiids (Emeljanov 2002) - with a few exceptions such as their absence in Pentastiridius (Podaplus) Emeljanov, 1995, and together with presence of a diastema as in the Uzbekistan species Pentastiridius (Podaplus) subterraneus Emeljanov, 1995). The diastema seems characteristic of the oecleine lineage tribes (Emeljanov 2002).

3. Ecological classification

In the cave, specimens (adults and nymphs) were found in two different “cixiid nests” made of aggregated rootlets by abundant waxy filaments (Fig. 1) and forming distinct galleries, in which the specimens were walking. These nests were located in the transitional but obscure zone of the cave at about 1 m from the cave floor for the first one. Several other smaller waxy nests were observed in other root masses, but no adults were observed there. All adults remained inside the nest and were never observed isolated outside the nest. When disturbed, adults would slowly walk away, and were never observed jumping or even flying. In several places in the deep cave zone, nymphs (at least 3rd to 5th instar) were observed walking on the rock surface of the cave walls, usually close to the floor and often close to small roots.

The cave is located in an area well studied with regard to its epigean fauna and which has been regularly sampled over many years, however no epigeal population had ever been reported. Like all cixiids, the nymphs live in a hypogeous environment, but the adults also stay underground - without being forced to do so by the ants who would exploit them for trophobiosis (Myers 1929; Bourgoin et al. in prep). The adults live together in the “cixidian nest” consisting of rootlets and waxy filaments produced by the nymphs of different stages which are present along the adults. In the nest, specimens can most likely communicate via the root substrate as do other planthoppers (Hoch and Howarth 1993; Soulier-Perkins et al. 2007), feed and reproduce there. Thus, Cofromalaxius remains only known from the hypogean habitat where it completes its full life cycle. Based on our observaions, rather than a subtroglophile species living temporally or cyclically in hypogean conditions such as its sister taxa Trigonocranus emmeae (Hoch et al. 2013), Coframalaxius bletteryi should be considered as an eutroglophile species (Sket 2008: 1560). Further field investigations on the life history of C. bletteryi will confirm its ecological status.

4. Conservation

Coframalaxius bletteryi , having been found in a single cave in southern France, shows an extreme degree of endemism. The species is specialized to live underground presumably feeding on roots of epigean plants, and according to field observations, has a presumed small population size. These criteria comply with the IUCN Red Data Book categories “vulnerable”, or even “endangered” (IUCN 2019). This categorization, however, must be regarded preliminary. It is conceivable that the cave where the only known specimens have been found, is but a window to a much more extended superficial underground compartment, or MSS (milieu souterranin superficiel, as described by Juberthie et al. 1980), which is well developed in the mountainous regions of Europe (Juberthie 1995). According to Juberthie (1995: 20) the MSS, especially in the Mediterranean regions, at lower elevations forms a mosaic of habitats.

It is thus likely that C. bletteryi has a wider distribution in southern France. Nonetheless, there are potential threats to the species and to its environment. Increased publicity of the occurrence of the new species may increase the number of visitors and put the population of C. bletteryi at risk, either through collecting or vandalism, such as damaging roots by trampling or voluntary destruction. Indirect, yet no less severe threats may come from threats to the surface environment, such as droughts, forest fires, as well as deforestation, road construction, and other alteration of surface vegetation. Extirpation of the population in the respective cave would perhaps not mean extinction of the species, however, it would destroy the unique chance to investigate the biology of one of France´s rarest endemic species.

Acknowledgements

We thank all the colleagues who allowed the field trip leading to the discovery of this new species to take place in these excellent conditions: CDS 06, Club Magnan with Alexandre Vandekerkhove and the Sofitaupes Club with Frédéric Bonacossa, Michel Radecki and Eric Madeleine for offering us their expertise on the cavities of the East-Var sector. A huge thank you to Jean-Michel Lemaire, for his particularly fruitful prospecting advice and for having been available day by day to guide us through the meanders of the valleys of the Alpes-maritmes. Special thanks to Emilie Gohier and Denwal Lecoq for their precious help during the field trip, to Jonathan Blettery who guided us during all our field trip, and allowed us to explore the caves in complete security, and to Sunbin Huang for the photographies “in vivo” he took (Fig. 1). We also thank Jerôme Constant from the Royal Institute of Natural Science of Brussels and Mike Wilson from the National Museum of Wales for their loan of specimen of Trigonocranus emmeae Fieber, 1876 allowing us to compare the two species, and Deqiang Ai and Manon Bucher for the sequencing in the T. emmeae and C. bletteryi.

References

  • Attié M, Bourgoin T, Bonfils J (2002) The Cixiidae (Hemiptera, Fulgoromorpha) from Mascarenes islands and Madagascar. Endemism and description of new taxa from Réunion with notes on their host plants. European Journal of Entomology 99: 543–555. https://doi.org/10.14411/eje.2002.071
  • Bahder BW, Barrantes Barrantes EA, Zumbado Echavarria MA, Mou DF, Helmick EE, Bartlett CR (2020) A new species of planthopper in the genus Haplaxius (Hemiptera: Auchenorrhyncha: Fulgoroidea: Cixiidae) on palms in Costa Rica and a new country record for Haplaxius skarphion. Zootaxa 4767(4): 543–552. https://doi.org/10.11646/zootaxa.4767.4.4
  • Bahder BW, Bartlett CR, Barrantes Barrantes EA, Zumbado Echavarria MA, Humphries AR, Helmick EE, Goss EM, Ascunce MS (2019) A new genus and species of cixiid planthopper (Hemiptera: Auchenorrhyncha: Fulgoroidea) from the Reserva Privada el Silencio de Los Angeles Cloud Forest in Costa Rica. Zootaxa 4701(1): 65–81. https://doi.org/10.11646/zootaxa.4701.1.5
  • Barrantes Barrantes EA, Zumbado Echavarria MA, Bartlett CR, Helmick EE, Bahder BW (2021) A new species of planthopper in the genus Haplaxius (Hemiptera: Auchenorrhyncha: Fulgoroidea: Cixiidae) from coconut palm (Cocos nucifera) in Costa Rica. Zootaxa 4963(3): 412–422. https://doi.org/10.11646/zootaxa.4963.3.2
  • Bourgoin T (1988) A new interpretation of the homologies of the Hemiptera male genitalia, illustrated by the Tettigometridae (Hemiptera, Fulgoromorpha). In: Vidano C, Arzone A (Eds) Proccedings of the 6thAuchenorrhyncha Meeting, Turin, Italy, September 7–11, 1987. Consiglio Nazionale delle Ricerche-Special Project IPRA, Turin, 113–120.
  • Bourgoin T (1993) Female genitalia in Hemiptera Fulgoromorpha, morphological and phylogenetic data. Annales de la Société entomologique de France (N.S. ) 29: 225–244.
  • Bourgoin T, Wang RR, Asche M, Hoch H, Soulier-Perkins A, Stroinski A, Yap S, Szwedo J (2015) From micropterism to hyperpterism: Recognition strategy and standardized homology-driven terminology of the forewing venation patterns in planthoppers (Hemiptera: Fulgoromorpha). Zoomorphology 134: 63–77. https://doi.org/10.1007/s00435-014-0243-6
  • Burmeister HCC (1835) Schnabelkerfe. Rhynchota. Fascicule 1. In: Burmeister HCC (Ed. ) Handbuch der Entomologie 2: 99–183
  • D’Urso V, Grasso R (2009) First record of troglobitic Fulgoromorpha from Italy (Hemiptera, Auchenorrhyncha, Cixiidae). Deutsche Entomologische Zeitschrift 56(1): 1–14. https://doi.org/10.1002/mmnd.200900002
  • Emeljanov AF (2002) Contribution to classification and phylogeny of the family Cixiidae (Hemiptera, Fulgoromorpha). Denisia 4: 103–112.
  • Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010) New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic biology 59(3): 307–321. https://doi.org/10.1093/sysbio/syq010
  • Hoch H, Howarth FG (1993) Evolutionary dynamics of behavioral divergence among populations of the Hawaiian cave-dwelling planthopper Oliarus polyphemus (Homoptera: Fulgoroidea: Cixiidae). Pacific Science 47: 303–318.
  • Hoch H (1994) Homoptera (Auchenorrhyncha Fulgoroidea). In: Juberthie C, Decu V (Eds) Encyclopedia Biospeologica. Société de Biospéologie, Moulis-Bucarest, 313–325.
  • Hoch H (2013) Trirhacus helenae sp.n., a new cave-dwelling planthopper from Croatia (Hemiptera: Fulgoromorpha: Cixiidae). Deutsche Entomologische Zeitschrift 60(2): 155–161.
  • Hoch H, Mühlethaler R, Wessel A (2013) Acoustic communication in the subtroglophile planthopper Trigonocranus emmeae Fieber, 1876 (Hemiptera: Fulgoromorpha: Cixiidae: Oecleini). Acta Musei Moraviae, Scientiae biologicae (Brno) 98(2): 155–162.
  • Hoch H, Sendra A, Montagud S, Teruel S, Lopes Ferreira R (2021) First record of a cavernicolous Kinnaridae from the Old World (Hemiptera, Auchenorrhyncha, Fulgoromorpha, Kinnaridae, Adolendini) provides testimony of an ancient fauna. Subterranean Biology 37: 1–26. https://doi.org/10.3897/subtbiol.37.60483
  • Howarth FG, Moldovan OT (2018) The ecological classification of cave animals and their adaptations. In: Moldovan OT, Kovács L, Halse S (Eds) Cave Ecology, Ecological Studies 235. Springer Nature Switzerland, 41–67. https://doi.org/10.1007/978-3-319-98852-8_4
  • Juberthie C, Delay B, Bouillon M (1980) Extension du milieu souterrain en zone non-calcaire. Mémoires de Biospéologie 7: 19–52.
  • Juberthie C (1995) Underground habitats and their protection. Nature and Environment, No. 72. Council of Europe Press, 158 pp.
  • Lanfear R, Hua X, Warren DL (2016) Estimating the effective sample size of tree topologies from Bayesian phylogenetic analyses. Genome Biology and Evolution 8(8): 2319–2332. https://doi.org/10.1093/gbe/evw171
  • Letunic I, Bork P (2021) Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Research 49 (W1): W293–W296. https://doi.org/10.1093/nar/gkab301
  • Luo Y, Bourgoin T, Szwedo J, Feng JN (2021) Acrotiarini trib. nov., in the Cixiidae (Insecta, Hemiptera, Fulgoromorpha) from mid-Cretaceous amber of northern Myanmar, with new insights in the classification of the family. Cretaceous Research 128: e104959. https://doi.org/10.1016/j.cretres.2021.104959
  • Minh BQ, Nguyen MAT, von Haeseler A (2013) Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution 30(5): 1188–1195. https://doi.org/10.1093/molbev/mst024
  • Myrie W, Helmick EE, Bartlett CR, Bertaccini A, Bahder BW (2019) A new species of planthopper belonging to the genus Oecleus Stål, 1862 (Hemiptera: Fulgoroidea: Cixiidae) from coconut palm (Cocos nucifera L) in Jamaica. Zootaxa 4712(1): 127–137. https://doi.org/10.11646/zootaxa.4712.1.9
  • Nguyen LT, Schmidt HA, Von Haeseler A, Minh BQ (2015) IQ-TREE: a fast and effective stochastic. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300
  • Racovitza EG (1907) Essai sur les problèmes biospéologiques. Archives de Zoologie Experimentale et Générale 4(6): 371–488
  • Soulier-Perkins A, Sueur J, Hoch H (2007) Historical use of substrate-borne acoustic production within the Hemiptera: first record for an Australian Lophopid (Hemiptera, Lophopidae). Australian Journal of Entomology (2007) 46: 129–132. https://doi.org/10.1111/j.1440-6055.2007.00566.x
  • Szwedo J (2002) The first fossil Bothriocerinae from Eocene Baltic amber with notes on recent taxa (Hemiptera: Fulgoromorpha: Cixiidae). Deutsche entomologische Zeitschrift. Berlin 49(2): 197–207. https://doi.org/10.1002/mmnd.4810490204
  • Wilson SW, Tsai JH (1982) Descriptions of the immature stages of Myndus crudus (Homoptera: Fulgoroidea: Cixiidae). Journal of the New York Entomological Society 90: 166–175.
  • Wilson SW, Tsai JH, Thomson CR (1983) Descriptions of the nymphal instars of Oecleus borealis (Homoptera: Fulgoroidea: Cixiidae). Journal of the New York Entomological Society 91: 418–423.
  • Zhang D, Gao F, Jakovlić I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: an integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular ecology resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096
  • Zumbado Echavarria MA, Barrantes Barrantes EA, Bartlett CR, Helmick EE, Bahder BW (2021a) A new species of planthopper in the genus Myxia (Hemiptera: Auchenorrhyncha: Cixiidae) from the Reserva Privada el Silencio de Los Angeles Cloud Forest in Costa Rica. Zootaxa 4915(3): 351–363. https://doi.org/10.11646/zootaxa.4915.3.4
  • Zumbado Echavarria MA, Barrantes Barrantes EA, Batlett CR, Helmick EE, Bahder BW (2021b) A new species of Myxia (Hemiptera: Auchenorrhyncha: Cixiidae) collected on palms from the Reserva Privada el Silencio de Los Angeles Cloud Forest in Costa Rica. Zootaxa 5027(3): 417–428. https://doi.org/10.11646/zootaxa.5027.3.7
login to comment