Research Article |
Corresponding author: Luis Espinasa ( luis.espinasa@marist.edu ) Academic editor: Oana Teodora Moldovan
© 2018 Joseph Kopp, Shristhi Avasthi, Luis Espinasa.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Kopp J, Avasthi S, Espinasa L (2018) Phylogeographical convergence between Astyanax cavefish and mysid shrimps in the Sierra de El Abra, Mexico. Subterranean Biology 26: 75-84. https://doi.org/10.3897/subtbiol.26.27097
|
The Sierra de El Abra is a long (120 km) and narrow (10 km) karstic area in northeastern Mexico. Some studies have suggested independent evolutionary histories for the multiple populations of blind cavefish Astyanax mexicanus that inhabit this mountain range, despite the hydrological connections that may exist across the Sierra. Barriers between caves could have prevented stygobitic populations to migrate across caves, creating evolutionary significant units localized in discrete biogeographical areas of the Sierra de El Abra. The goal of the present study was to evaluate if there is a correspondence in phylogeographical patterns between Astyanax cavefish and the stygobitic mysid shrimp Spelaeomysis quinterensis. Astyanax mtDNA and mysid histone H3 DNA sequences showed that in both species, cave populations in central El Abra, such as Tinaja cave, are broadly different from other cave populations. This phylogeographical convergence supports the notion that the central Sierra de El Abra is a biogeographical zone with effective barriers for either cave to cave or surface to cave gene flow, which have modulated the evolutionary history across species of its aquatic stygobitic community.
Sierra de El Abra, cavefish, Spelaeomysis quinterensis , Astyanax mexicanus , convergent evolution, phylogeography
The teleost Astyanax mexicanus has become one of the most influential models for studying regressive evolution and cave adapted organisms. The species consists of several eyeless, depigmented cave-dwelling forms and eyed, pigmented surface-dwelling forms. Since the forms remain interfertile, this allows exploration of the molecular, genetic, and developmental mechanisms of adaptation to the cave environment (
Initial genetic studies with isoenzymes (
Recent studies evaluating mtDNA, nuclear and genomic data in cave and surface populations of Astyanax have shown a discordance between nuclear and mitochondrial phyletic patterns (e.g. Strecker et al. 2011; Coghill et al. 2014,
Samples of Astyanax cavefish (Fig.
Cave localities of A. mexicanus whose mitochondrial DNA has been analyzed. With larger font and underlined are localities where S. quinterensis were also collected. In red are caves harboring lineage A and in blue those with lineage B for both mtDNA in Astyanax and histone 3 for S. quinterensis. Notice that lineage B is restricted to a small biogeographical zone, circled in blue. A Molino B Caballo Moro C Pachón D Yerbaniz E Japones F Sabinos G Tinaja H Piedras I Curva J Chica K Chiquitita L Rio Subterraneo. (Figure modified from
Samples were also collected from a surface locality inhabited by Lineage A Astyanax; Río Comandante (N=2), and from two surface localities inhabited by Lineage B Astyanax; Rascón (N=2) and Tamasopo (N=1). Collecting permit # SGPA/DGVS/02438/16 from Secretaría del Medio Ambiente y Recursos Naturales, México, was issued to Patricia Ornelas García.
Samples of S. quinterensis were collected from four different cave localities (Fig.
Genomic DNA was extracted using Qiagen’s DNEasy® Tissue Kit by digesting a fin clip or a leg in lysis buffer. For Astyanax samples, all markers were amplified and sequenced as a single fragment using the 16Sar (5’ CGCCTGTTTATCAAAAACAT 3’) and 16sb (5’ CTCCGGTTTGAACTCAGATCA 3’) primer pair for mitochondrial 16S rRNA, following standard protocols (
All fragments for the mitochondrial 16S rRNA of Astyanax were 572 bp long. There were no indels when aligning the sequences. Specimens from Molino, Caballo Moro, Pachón, Chica, and Chiquitita caves and from the surface locality of Río Comandante all had identical sequences, except one out of four specimens from Chiquitita cave that differed by 1 bp (0.17%). The consensus sequence was also identical to GenBank sequence (AP011982.1) of “Astyanax mexicanus mitochondrial DNA, almost complete genome”. Since the localities of Molino, Pachón, Chica and Río Comandante are previously known to harbor lineage A mtDNA (
The cave populations of Sabinos, Tinaja and Curva had identical sequences. Likewise the surface populations of Rascón and Tamasopo were identical. These five localities are known to harbor fish from the Lineage B (
Regarding the mysid shrimp, the H3 fragment from all seven specimens were 328 bp long (GenBank # MH422492–MH422494). There was no need for insertions or deletions to align the sequences. In the localities where more than one specimens was sequenced (Pachón N=2 and Tinaja N=3), no variability within populations was found and their sequences were identical. Two clades or lineages were found. The first lineage included specimens from Caballo Moro, Pachón and Chiquitita. The second lineage was made of Tinaja (Fig.
Pylogeographical convergence between mysid shrimps in the Sierra de El Abra and the mtDNA of Astyanax cavefish (right). Both aquatic species harbor the evolutionary signature of a phylogeographical discordance, where genetic markers of populations in central Sierra de El Abra are extremely distinct from the rest of the populations. Nuclear tree (left) based on the consensus of isoenzymes, RAPDs, microsatellite, and genomic sequences. a) Pachón as representative of northern populations. b-c) Sabinos and Tinaja as representative of central populations. d) Chica and Chiquitita as representative of southern populations.
To our knowledge, a total of 12 out of the 30 caves known to harbor cavefish in the El Abra region have had their mtDNA sequenced thus far, with the inclusion of the new Astyanax populations of this study. From this wealth of data, a pattern seems to emerge (Figs
Results obtained from the stygobitic shrimp suggest that mysids in central Sierra de El Abra (Tinaja) derive also from a separate lineage different from the rest of the Sierra de El Abra (Pachón and Chiquitita caves) and Sierra de Guatemala (Caballo Moro) populations. This implies that the aquatic mysid shrimps had at least two separate evolutionary histories, or lineages, which are linked to distinct geographical areas within the Sierra de El Abra. The phylogeography of the mysids lineages is in agreement and overlaps with the mitochondrial lineages of Astyanax cavefish (Fig.
Since this pattern has now been shown to be similar in two distinct taxa of aquatic organisms, Astyanax and mysid shrimps, it is proposed that independent colonization and/or underground barriers have created a separate biogeographical zones that promotes independent evolutionary histories across aquatic communities. Alternatively, some caves in this central zone are less connected to surface systems and therefore less prompt to be colonized or introgressed by surface populations. If surface gene flow is more difficult in the central area (i.e. Tinaja), this isolation could lead to population differentiation as observed in both mitochondrial Astyanax and in mysid shrimps. A caveat of this hypothesis is that it would require mysid shrimps to currently have a surface morph or a surface ancestor that has or had access to only northern and southern caves in recent times. Spelaeomysis quinterensis is a highly troglomorphic species that is unlikely to survive on the surface, and unlike Astyanax, no surface morph has been described. This study opens the necessity to further investigate the sister group of this species to better understand the evolutionary history of this group and their adaptation to the caves environment. Furthermore, any proposed barriers should not be considered as completely impermeable and effective to eliminate all gene flow. This is evidenced in nuclear sequences in Astyanax which show a different pattern from mitochondrial data, corroborating that at least some gene flow either from within the caves or from surface to caves exist (
Barriers for dispersal for aquatic and terrestrial organisms in the El Abra caves appear to be different.
In conclusion, phylogeographic results obtained from the mysid Shrimp, Spelaeomysis quinterensis mimic the results of mitochondrial studies in Astyanax. This suggests that the geographic distribution of mitochondrial lineages in Astyanax is neither stochastic, nor exclusively explained by linkage to paternally inherited characters on distinct populations. Instead it supports that Sierra de El Abra has distinct biogeographic areas, with partial barriers that affect evolutionary histories creating evolutionary significant units for all members across different species of the aquatic cave community.
We would like to thank Sylvie Retaux, Emily Collins, Jenna Robinson, Jennifer Rutkowski, and Christian Schroeder who helped with specimen collection and or analysis. Patricia Ornelas-Garcia for reviewing the manuscript. Sequencing was performed with the help of students of the Spring 2017 BIOL320 Genetics course at Marist College. Partial support for the project was granted by the School of Science at Marist College and VPAA grants.